Journal: Cells

Article Title: Cap-Specific m 6 Am Methyltransferase PCIF1/CAPAM Regulates mRNA Stability of RAB23 and CNOT6 through the m 6 A Methyltransferase Activity

doi: 10.3390/cells13201689

Figure Lengend Snippet: Exploration of PCIF1 target genes by genome-wide gene expression analysis. ( A ) RT-qPCR analysis of total RNAs isolated from HeLa cells treated with control siRNA (siNC) or two distinct PCIF1-targeted siRNAs (siPCIF1 #1 and #2). ( B ) Immunoblotting analysis of total protein extracts from HeLa cells treated with control siRNA (siNC) and two distinct PCIF1-targeted siRNAs (siPCIF1 #1 and #2) with anti-PCIF1 and anti-b-actin antibodies. ( C , D ) Venn diagrams showing the overlap between the two indicated siRNA-mediated downregulated ( C ) and upregulated ( D ) genes identified by the gene expression profile analyzed by DNA microarray using a Human Genome U133 Plus 2.0 Array (Affymetrix). The condition for selecting differentially expressed genes are as follows: (1) cut-off condition: expression > 100, (2) fold change: >2, (3) p -value < 0.05.

Article Snippet: An amount of 1.5 μg of anti-m 6 A antibody (Abcam Limited, Cambridge, UK, ab151230) or normal rabbit IgG (Medical & Biological Laboratories Co.) was incubated with 30 μL of Dynabeads Protein G (Thermo Fisher Scientific) at room temperature for 1 h. Total RNA (50 μg) was added to the antibody-Dynabead complexes and incubated at 4 °C for 4 h. After washing three times, the bound RNA was purified from the beads using SepasolTM-RNA I Super G. The first strand of cDNA was synthesized from m 6 A-RNA using ReverTra AceTM qPCR RT Master Mix with gDNA Remover (Toyobo Co., Osaka, Japan) with random hexamer primers according to the manufacturer’s instructions. cDNA was quantified using GeneAce SYBRTM qPCR Mix II (Nippon Gene Co., Tokyo, Japan) and a Mx3000P real-time PCR system (Agilent).

Techniques: Genome Wide, Gene Expression, Quantitative RT-PCR, Isolation, Control, Western Blot, Microarray, Expressing

Journal: Cells

Article Title: Cap-Specific m 6 Am Methyltransferase PCIF1/CAPAM Regulates mRNA Stability of RAB23 and CNOT6 through the m 6 A Methyltransferase Activity

doi: 10.3390/cells13201689

Figure Lengend Snippet: Expression of RAB23 and CNOT6 is regulated by PCIF1 at both the mRNA and protein levels. ( A – C ) RT-qPCR analysis of total RNAs isolated from HeLa cells treated with control siRNA (siNC) and two distinct PCIF1-targeted siRNAs (siPCIF1 #1 and #3), using the specific primer set detecting PCIF1 ( A ), RAB23 ( B ), and CNOT6 ( C ) expression. ( D , E ) Immunoblotting analysis of total protein extracts from HeLa cells treated with control siRNA (siNC) and two distinct PCIF1-targeted siRNAs (siPCIF1 #1 and #3) with the indicated antibodies. Signal intensities obtained from immunoblotting were quantified using ImageJ software version 1.52. The y-axis represents the fold change relative to the levels in HeLa cells treated with control siRNA. Data are expressed as the mean ± standard deviation of three independent experiments. Asterisks represent statistically significant differences between the control siRNA treatment and the indicated PCIF1-targeted siRNA (Student’s t -test, * p < 0.05, ** p < 0.01, *** p < 0.001).

Article Snippet: An amount of 1.5 μg of anti-m 6 A antibody (Abcam Limited, Cambridge, UK, ab151230) or normal rabbit IgG (Medical & Biological Laboratories Co.) was incubated with 30 μL of Dynabeads Protein G (Thermo Fisher Scientific) at room temperature for 1 h. Total RNA (50 μg) was added to the antibody-Dynabead complexes and incubated at 4 °C for 4 h. After washing three times, the bound RNA was purified from the beads using SepasolTM-RNA I Super G. The first strand of cDNA was synthesized from m 6 A-RNA using ReverTra AceTM qPCR RT Master Mix with gDNA Remover (Toyobo Co., Osaka, Japan) with random hexamer primers according to the manufacturer’s instructions. cDNA was quantified using GeneAce SYBRTM qPCR Mix II (Nippon Gene Co., Tokyo, Japan) and a Mx3000P real-time PCR system (Agilent).

Techniques: Expressing, Quantitative RT-PCR, Isolation, Control, Western Blot, Software, Standard Deviation

Journal: Cells

Article Title: Cap-Specific m 6 Am Methyltransferase PCIF1/CAPAM Regulates mRNA Stability of RAB23 and CNOT6 through the m 6 A Methyltransferase Activity

doi: 10.3390/cells13201689

Figure Lengend Snippet: Ectopic expression of siRNA-resistant PCIF1 restores the normal levels of target mRNA expression. ( A , B ) RT-qPCR analysis of total RNAs isolated from HeLa cells transfected with a control empty vector (Vec) or a vector expressing siRNA-resistant PCIF1 (PCIF1siR) under treatment with control siRNA (siNC) or PCIF1-targeted siRNAs (siPCIF1 #3), using the specific primer set detecting RAB23 ( A ) and CNOT6 ( B ) expression. The y -axis represents the fold change relative to the levels in HeLa cells treated with control siRNA. Data are expressed as the mean ± standard deviation of three independent experiments. Asterisks represent statistically significant differences between indicated pairs (Student’s t -test, *** p < 0.001).

Article Snippet: An amount of 1.5 μg of anti-m 6 A antibody (Abcam Limited, Cambridge, UK, ab151230) or normal rabbit IgG (Medical & Biological Laboratories Co.) was incubated with 30 μL of Dynabeads Protein G (Thermo Fisher Scientific) at room temperature for 1 h. Total RNA (50 μg) was added to the antibody-Dynabead complexes and incubated at 4 °C for 4 h. After washing three times, the bound RNA was purified from the beads using SepasolTM-RNA I Super G. The first strand of cDNA was synthesized from m 6 A-RNA using ReverTra AceTM qPCR RT Master Mix with gDNA Remover (Toyobo Co., Osaka, Japan) with random hexamer primers according to the manufacturer’s instructions. cDNA was quantified using GeneAce SYBRTM qPCR Mix II (Nippon Gene Co., Tokyo, Japan) and a Mx3000P real-time PCR system (Agilent).

Techniques: Expressing, Quantitative RT-PCR, Isolation, Transfection, Control, Plasmid Preparation, Standard Deviation

Journal: Cells

Article Title: Cap-Specific m 6 Am Methyltransferase PCIF1/CAPAM Regulates mRNA Stability of RAB23 and CNOT6 through the m 6 A Methyltransferase Activity

doi: 10.3390/cells13201689

Figure Lengend Snippet: PCIF1 does not regulate expression of its target genes at the transcriptional level. ( A , E ) Schematic illustrations of the RAB23 ( A ) and CNOT6 ( E ) genes. The transcription start sites are indicated by arrows, the exons are shown as black boxes, and the polyadenylation signals are indicated by arrowheads. The positions of the PCR primer set for RT-qPCR amplification of the precursor and mature mRNAs are indicated by arrows. ( B – D , F – H ) RT-qPCR analysis of total RNAs isolated from HeLa cells treated with control siRNA (siNC) and two distinct PCIF1-targeted siRNAs (siPCIF1 #1 and #3) using the indicated primer sets. ( I , J ) ChIP analyses of the RAB23 ( I ) and CNOT6 ( J ) gene promoters (position 2 in ) using antibodies against Pol II in HeLa cells treated with control siRNA (siNC) and two distinct PCIF1 targeted siRNAs (siPCIF1 #1 and #3). Normal rabbit IgG was used as the negative control. Data are expressed as the mean ± standard deviation of three independent experiments. Asterisks represent statistically significant differences between the control siRNA treatment and the indicated PCIF1 targeted siRNA (Student’s t -test, n.s. p > 0.05, *** p < 0.001).

Article Snippet: An amount of 1.5 μg of anti-m 6 A antibody (Abcam Limited, Cambridge, UK, ab151230) or normal rabbit IgG (Medical & Biological Laboratories Co.) was incubated with 30 μL of Dynabeads Protein G (Thermo Fisher Scientific) at room temperature for 1 h. Total RNA (50 μg) was added to the antibody-Dynabead complexes and incubated at 4 °C for 4 h. After washing three times, the bound RNA was purified from the beads using SepasolTM-RNA I Super G. The first strand of cDNA was synthesized from m 6 A-RNA using ReverTra AceTM qPCR RT Master Mix with gDNA Remover (Toyobo Co., Osaka, Japan) with random hexamer primers according to the manufacturer’s instructions. cDNA was quantified using GeneAce SYBRTM qPCR Mix II (Nippon Gene Co., Tokyo, Japan) and a Mx3000P real-time PCR system (Agilent).

Techniques: Expressing, Quantitative RT-PCR, Amplification, Isolation, Control, Negative Control, Standard Deviation

Journal: Cells

Article Title: Cap-Specific m 6 Am Methyltransferase PCIF1/CAPAM Regulates mRNA Stability of RAB23 and CNOT6 through the m 6 A Methyltransferase Activity

doi: 10.3390/cells13201689

Figure Lengend Snippet: PCIF1 regulates the stability of target gene mRNAs in opposite ways. After HeLa cells were treated with a negative control siRNA (siNC) and two PCIF1-targeted siRNAs (siPCIF1 #1 and #3) for 72 h, actinomycin D was added to inhibit transcription. Cells were harvested at 0, 2, 4, 8, and 12 h after treatment, and total RNA was isolated. The amount of residual mRNA was analyzed by RT-qPCR at each time point, using the specific primer set detecting PCIF1 ( A ), CRAB23 ( B ), and CNOT6 ( C ) mRNAs. The relative value was calculated using the expression level of β-actin mRNA (ACTB) as a normalizer. The relative values at each time point were calculated relative to time zero. Asterisks represent statistically significant differences between the control siRNA treatment and the indicated PCIF1-targeted siRNA (Student’s t -test, * p < 0.05, *** p < 0.001).

Article Snippet: An amount of 1.5 μg of anti-m 6 A antibody (Abcam Limited, Cambridge, UK, ab151230) or normal rabbit IgG (Medical & Biological Laboratories Co.) was incubated with 30 μL of Dynabeads Protein G (Thermo Fisher Scientific) at room temperature for 1 h. Total RNA (50 μg) was added to the antibody-Dynabead complexes and incubated at 4 °C for 4 h. After washing three times, the bound RNA was purified from the beads using SepasolTM-RNA I Super G. The first strand of cDNA was synthesized from m 6 A-RNA using ReverTra AceTM qPCR RT Master Mix with gDNA Remover (Toyobo Co., Osaka, Japan) with random hexamer primers according to the manufacturer’s instructions. cDNA was quantified using GeneAce SYBRTM qPCR Mix II (Nippon Gene Co., Tokyo, Japan) and a Mx3000P real-time PCR system (Agilent).

Techniques: Negative Control, Isolation, Quantitative RT-PCR, Expressing, Control

Journal: Cells

Article Title: Cap-Specific m 6 Am Methyltransferase PCIF1/CAPAM Regulates mRNA Stability of RAB23 and CNOT6 through the m 6 A Methyltransferase Activity

doi: 10.3390/cells13201689

Figure Lengend Snippet: Ectopic expression of siRNA-resistant wild-type but not methyltransferase-deficient mutant PCIF1 restored normal levels of target mRNA expression. ( A ) Immunoblotting analysis of total protein extracts from HeLa cells transfected with a control empty vector (Vec), a vector expressing siRNA-resistant wild-type PCIF1 (siR_wt), or methyltransferase-deficient mutant PCIF1 (siR_mut) under treatment with control siRNA (siNC) or PCIF1-targeted siRNAs (siPCIF1: siPCIF1 #3 was used for PCIF1 suppression) with the indicated antibodies. ( B , C ) RT-qPCR analysis of total RNAs isolated from HeLa cells treated as in ( A ), using the specific primer set detecting RAB23 ( B ) and CNOT6 ( C ) expression. Data are expressed as the mean ± standard deviation of three independent experiments. Asterisks represent statistically significant differences between the indicated pairs (Student’s t -test, n.s. p > 0.05, * p < 0.05, ** p < 0.01, *** p < 0.001).

Article Snippet: An amount of 1.5 μg of anti-m 6 A antibody (Abcam Limited, Cambridge, UK, ab151230) or normal rabbit IgG (Medical & Biological Laboratories Co.) was incubated with 30 μL of Dynabeads Protein G (Thermo Fisher Scientific) at room temperature for 1 h. Total RNA (50 μg) was added to the antibody-Dynabead complexes and incubated at 4 °C for 4 h. After washing three times, the bound RNA was purified from the beads using SepasolTM-RNA I Super G. The first strand of cDNA was synthesized from m 6 A-RNA using ReverTra AceTM qPCR RT Master Mix with gDNA Remover (Toyobo Co., Osaka, Japan) with random hexamer primers according to the manufacturer’s instructions. cDNA was quantified using GeneAce SYBRTM qPCR Mix II (Nippon Gene Co., Tokyo, Japan) and a Mx3000P real-time PCR system (Agilent).

Techniques: Expressing, Mutagenesis, Western Blot, Transfection, Control, Plasmid Preparation, Quantitative RT-PCR, Isolation, Standard Deviation

Journal: Cells

Article Title: Cap-Specific m 6 Am Methyltransferase PCIF1/CAPAM Regulates mRNA Stability of RAB23 and CNOT6 through the m 6 A Methyltransferase Activity

doi: 10.3390/cells13201689

Figure Lengend Snippet: PCIF1 suppression resulted in a significant decrease in m 6 A levels of both RAB23 and CNOT6 mRNAs. MeRIP-qPCR analysis was performed using HeLa cells treated with control siRNA (siNC) or PCIF1-targeted siRNA (siPCIF1: siPCIF1 #3 was used for PCIF1 suppression). RT-qPCR analysis of RNAs purified from the immunoprecipitates of HeLa cell extracts using the anti-m 6 A antibody, using the specific primer set detecting RAB23 ( A ), CNOT6 ( B ), and ACTB ( C ) mRNAs. The y -axis represents the fold change relative to the RNA levels in the immunoprecipitate by anti-m 6 A antibody from HeLa cells treated with control siRNA (siNC). Normal rabbit IgG (IgG) was used as a negative control. Data are expressed as the mean ± standard deviation of three independent experiments. Asterisks represent statistically significant differences between the indicated pairs (Student’s t -test, n.s. p > 0.05, *** p < 0.001).

Article Snippet: An amount of 1.5 μg of anti-m 6 A antibody (Abcam Limited, Cambridge, UK, ab151230) or normal rabbit IgG (Medical & Biological Laboratories Co.) was incubated with 30 μL of Dynabeads Protein G (Thermo Fisher Scientific) at room temperature for 1 h. Total RNA (50 μg) was added to the antibody-Dynabead complexes and incubated at 4 °C for 4 h. After washing three times, the bound RNA was purified from the beads using SepasolTM-RNA I Super G. The first strand of cDNA was synthesized from m 6 A-RNA using ReverTra AceTM qPCR RT Master Mix with gDNA Remover (Toyobo Co., Osaka, Japan) with random hexamer primers according to the manufacturer’s instructions. cDNA was quantified using GeneAce SYBRTM qPCR Mix II (Nippon Gene Co., Tokyo, Japan) and a Mx3000P real-time PCR system (Agilent).

Techniques: Control, Quantitative RT-PCR, Purification, Negative Control, Standard Deviation

Journal: Frontiers in Immunology

Article Title: Identification of the novel FOXP3-dependent T reg cell transcription factor MEOX1 by high-dimensional analysis of human CD4 + T cells

doi: 10.3389/fimmu.2023.1107397

Figure Lengend Snippet: Assessment of T reg cell specific expression of MEOX1 (A) Expression of MEOX1 in activated T reg cells and T conv cells over a time period of 360 min (n=2; dataset: GSE11929). (B) MEOX1 gene expression in different immune cells assessed by qRT-PCR and normalized to B2M (n=3). *p < 0.05 (paired Student’s t-test), ** p < 0.01 (paired Student’s t-test). (C) MEOX1 gene expression in different immune cells according to the NextBio database. (D) Application of Markov Clustering Algorithm ‘MCL’ to the consensus network generated in Figure 2 . Visualized is a subnetwork consisting of only three genes (FOXP3, HPGD, and MEOX1). (E) Analysis of MEOX1 protein expression in either unstimulated T reg cells or in T reg cells stimulated with 100 U/ml IL-2 overnight by immunoblotting. (F) MFI (left) and exemplary histogram (right) of MEOX1 expression in human T reg cells and naïve T conv cells. PBMCs were isolated from buffy coats and stimulated overnight with 100 U/ml IL-2 (n=3 of different donors). T reg cells (red) were gated on size, singlets, live, CD4 + , CD3 + , FOXP3 + (Clone 206D), CD45RA - and T conv cells (blue) were gated on size, singlets, live, CD4 + , CD3 + , FOXP3 - (Clone 206D), CD45RA + . Secondary antibody controls are depicted in light (T reg cells) and dark grey (T conv cells). *p < 0.05 (paired Student’s t-test). (G) MEOX1 gene expression in T reg cells (red), T reg cells stimulated with IL-2 (light ref), T reg cells incubated with supernatant from stimulated T conv cells (rose) and T reg cells incubated with supernatant from stimulated T conv cells in combination with anti-CD25 and anti-IL-2 antibodies (grey) assessed by qRT-PCR and normalized to B2M. Data is from one representative experiment of three (mean and s.e.m.) with cells derived from different donors. *p < 0.05 (two-way ANOVA).

Article Snippet: CD25 MicroBeads II, human , Miltenyi Biotec , Cat# 130-092-983.

Techniques: Expressing, Gene Expression, Quantitative RT-PCR, Generated, Western Blot, Isolation, Incubation, Derivative Assay

Journal: Frontiers in Immunology

Article Title: Identification of the novel FOXP3-dependent T reg cell transcription factor MEOX1 by high-dimensional analysis of human CD4 + T cells

doi: 10.3389/fimmu.2023.1107397

Figure Lengend Snippet: FOXP3 as upstream regulator of MEOX1 expression. (A) Module genes correlated with ‘T reg cell CD3/IL-2’ which exhibit a FOXP3 binding-motif in their promoter region. Genes were colored according to their respective fold change (reference: ‘T conv cell resting’). (B) FOXP3 ChIP tiling array data from human expanded cord-blood T reg cells. Data were analyzed with MAT and overlayed to the MEOX1 locus to identify binding regions (p < 10 -5 and FDR < 0.5%). Data are representative of two independent experiments with cells derived from different donors. (C) Overlay of MeDip-seq and FOXP3 ChIP-seq data (SRA : SRP006674) for the human genomic MEOX1 locus. FOXP3 binding as well as DNA methylation is depicted for T reg (red) and T conv cells (blue). (D) mRNA expression of FOXP3 and MEOX1 in T reg cells treated with scrambled (scrmbld, left) or FOXP3 specific (right) siRNA (E) mRNA expression of FOXP3 and MEOX1 in T reg cells treated with scrambled (left) or MEOX1 specific (right) siRNA (F) mRNA expression of RPS27L in T reg cells treated with scrambled, MEOX1 or FOXP3 specific siRNA. (D–F) Data were first normalized to B2M expression and shown in relation to donor-specific scrambled mRNA expression. (D,E) *p < 0.05 (Student’s t-test). (F) *p < 0.05 (two-way ANOVA). (D–F) Data are representative of three to five independent experiments (mean ± s.e.m.), each with cells derived from a different donor. (G, H) Suppression of allogeneic CD4 + CD25 - T conv cells labelled with the cytosolic dye CFSE by human T reg cells transfected with siRNA targeting MEOX1 (MEOX1) or non-targeting siRNA (scrmbld) presented as CFSE dilution in responding T conv cells cultured with CD3/CD28/anti-MHC-I antibody-coated beads and T reg cells at a ratio of 1:1 (G) , and as relative suppression (H) . Data is from one representative experiment of three with cells derived from different donors. *p < 0.05 (paired Student’s t-test). n.s. = not significant.

Article Snippet: CD25 MicroBeads II, human , Miltenyi Biotec , Cat# 130-092-983.

Techniques: Expressing, Binding Assay, Derivative Assay, Methylated DNA Immunoprecipitation, ChIP-sequencing, DNA Methylation Assay, Transfection, Cell Culture

Journal: Frontiers in Immunology

Article Title: Identification of the novel FOXP3-dependent T reg cell transcription factor MEOX1 by high-dimensional analysis of human CD4 + T cells

doi: 10.3389/fimmu.2023.1107397

Figure Lengend Snippet:

Article Snippet: CD25 MicroBeads II, human , Miltenyi Biotec , Cat# 130-092-983.

Techniques: Recombinant, Reverse Transcription, Derivative Assay, Protease Inhibitor, One Step RT-PCR, Staining, cDNA Synthesis, SYBR Green Assay, Gel Extraction, Purification, Microarray, Methylated DNA Immunoprecipitation Sequencing, Modification, Software

Journal: Cell metabolism

Article Title: Cancer Lipid Metabolism Confers Antiangiogenic Drug Resistance.

doi: 10.1016/j.cmet.2018.05.005

Figure Lengend Snippet: Figure 1. Tumor and Angiogenesis Responses to AAD in Adipose and Non-adipose Tissues (A–H) CRC (A–D) and PDAC (E–H) tumors implanted in subcutaneous (non-adipose) and inguinal WAT were treated with a NIIgG or an anti-VEGF neutralizing antibody (n = 8–10 mice per group). Tumor growth (A–C and E–G) was measured as volumes (A, B, E, and F) and weight (C and G). Percentages of tumor inhibition were calculated (D and H). (I and K) Micrographs of CD31+ microvessels (red) in association with NG2+ pericytes (green in upper panels), leakiness of 70-kDa dextran (green in middle panels), and perfusion of 2000-kDa dextran (green in lower panels) in NIIgG- and anti-VEGF-treated non-adipose and adipose CRC (I) and PDAC (K) cancers. Arrows in upper panels point to NG2+ pericytes in association with tumor vessels. Arrowheads in middle panels indicate leaked dextran signals. Arrows in lower panels indicate perfused tumor vessels. Bar represents 100 mm. (J and L) Quantification of CD31+ tumor vessels (n = 5–10 random fields per group), pericyte-associated vessels (n = 5–10 random fields per group), extravasated 70-kDa dextran signals (n = 4–7 random fields per group), and perfusion of 2,000-kDa dextran (n = 4–7 random fields per group) in CRC (J) and PDAC (L) cancers. *p < 0.05; **p < 0.01; ***p < 0.001. NS, not significant. Data presented as means ± SEM. See also Figures S1 and S2.

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Chemicals, Peptides, and Recombinant Proteins Etomoxir Dr. Wolf-BioScience N/A MTT Sigma-Aldrich Cat# M5655 Clodronate liposomes FormuMax Cat# F70101C-N Control Liposomes FormuMax Cat# F70101-N Proteinase inhibitor cocktail Sigma-Aldrich Cat# P8340 Phosphatase inhibitor cocktail Cell Signaling Cat# 5870 Bodipy 558/568 C12 Invitrogen Cat# D-3835 D-luciferin PerkinElmer Cat# 122799 Critical Commercial Assays Cpt1 shRNA lentiviral particles Santa Cruz Biotechnology Cat# sc-40377-V Mycoplasma detection kit Lonza Cat# LT07-318 Pimonidazole Hypoxyprobe Cat# HP6-x cDNA Synthesis Kit Thermo Scientific Cat# K1632 Fast SYBR Green Master Mix Applied Biosystems Cat# 4385612 ATP assay kit Abnova Cat# KA0806 NEFA-HR(2) Assay Reagent 1 Wako Chemicals Cat# 434-91795 NEFA-HR(2) Assay Reagent 2 Wako Chemicals Cat# 434-91995 NEFA-HR(2) Assay Standard Wako Chemicals Cat# 270-77000 2000-kDa-lysinated fluorescein-labeled dextran Invitrogen Cat# D7137 2000-kDa-lysinated tetramethylrhodamine-labeled dextran Invitrogen Cat# D7139 70-kDa-lysinated fluorescein-labeled dextran Invitrogen Cat# D1822 70-kDa-lysinated tetramethylrhodamine-labeled dextran Invitrogen Cat# D1818 GeneJET RNA Purification Kit Thermo Scientific Cat# K0732 Deposited Data Affymetrix microarray data, mouse colorectal cancer grown in non-adipose or white adipose environment This paper GEO:GSE113507 Affymetrix microarray data, mouse colorectal cancer grown in healthy liver or fatty liver with or without antiangiogenic treatment This paper GEO:GSE113508 Experimental Models: Cell Lines MC38 murine colon adenocarcinoma Dr. Rubén Hernández, Center for Applied Medical Research, University of Navarra, Spain N/A Hepa1-6 murine hepatocellular carcinoma ATCC CRL-1830 PancO2 murine pancreatic ductal adenocarcinoma Dr. Maximilian Schnurr, Munich University, Germany N/A Experimental Models: Organisms/Strains Mouse: C57BL/6NJ Jackson Laboratory RRID:IMSR_JAX:005304 Mouse: CB17/Icr-Prkdcscid/IcrCrl Charles River RRID:IMSR_CRL:236 Oligonucleotides qRT-PCR primers.

Techniques: Inhibition

Journal: Cell metabolism

Article Title: Cancer Lipid Metabolism Confers Antiangiogenic Drug Resistance.

doi: 10.1016/j.cmet.2018.05.005

Figure Lengend Snippet: Figure 2. Anti-tumor and Antiangiogenic Responses of CRC and HCC Tumors Implanted in Normal and Steatotic Livers (A and E) Morphological and bioluminescent imaging analyses of tumor signals in healthy and steatotic livers. Arrows indicate surface CRC (A) and HCC (E) tumor nodules in healthy and steatotic livers. Bar represents 1 cm. (B and F) Quantification of liver weight (n = 3–6 mice per group), liver tumor volume (n = 5–7 mice per group), surface visible nodules (n = 5–7 mice per group), and photon counts (n = 6–10 mice per group) in CRC (B) and HCC (F) cancers. (C and G) Micrographs of CD31+ microvessels (red), leakiness of 70-kDa dextran (green in middle panels), and perfusion of 2,000-kDa dextran (green in lower panels) in NIIgG- and anti-VEGF-treated non-steatotic and steatotic CRC (C) and HCC (G) cancers. Arrows in upper panels point to CD31+ tumor vessels. Arrowheads in middle panels indicate extravasated dextran signals. Arrows in lower panels indicate perfused tumor vessels. Bar represents 100 mm. (D and H) Quantification of CD31+ tumor vessels (n = 8 random fields from three to six independent tumor samples per group), extravasated 70-kDa dextran signals (n = 5–6 random fields from three to six independent tumor samples per group), and perfusion of 2,000-kDa dextran (n = 6–8 random fields from three to six independent tumor samples per group) in CRC (D) and HCC (H) cancers. *p < 0.05; **p < 0.01; ***p < 0.001. NS, not significant. Data presented as means ± SEM. See also Figure S3.

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Chemicals, Peptides, and Recombinant Proteins Etomoxir Dr. Wolf-BioScience N/A MTT Sigma-Aldrich Cat# M5655 Clodronate liposomes FormuMax Cat# F70101C-N Control Liposomes FormuMax Cat# F70101-N Proteinase inhibitor cocktail Sigma-Aldrich Cat# P8340 Phosphatase inhibitor cocktail Cell Signaling Cat# 5870 Bodipy 558/568 C12 Invitrogen Cat# D-3835 D-luciferin PerkinElmer Cat# 122799 Critical Commercial Assays Cpt1 shRNA lentiviral particles Santa Cruz Biotechnology Cat# sc-40377-V Mycoplasma detection kit Lonza Cat# LT07-318 Pimonidazole Hypoxyprobe Cat# HP6-x cDNA Synthesis Kit Thermo Scientific Cat# K1632 Fast SYBR Green Master Mix Applied Biosystems Cat# 4385612 ATP assay kit Abnova Cat# KA0806 NEFA-HR(2) Assay Reagent 1 Wako Chemicals Cat# 434-91795 NEFA-HR(2) Assay Reagent 2 Wako Chemicals Cat# 434-91995 NEFA-HR(2) Assay Standard Wako Chemicals Cat# 270-77000 2000-kDa-lysinated fluorescein-labeled dextran Invitrogen Cat# D7137 2000-kDa-lysinated tetramethylrhodamine-labeled dextran Invitrogen Cat# D7139 70-kDa-lysinated fluorescein-labeled dextran Invitrogen Cat# D1822 70-kDa-lysinated tetramethylrhodamine-labeled dextran Invitrogen Cat# D1818 GeneJET RNA Purification Kit Thermo Scientific Cat# K0732 Deposited Data Affymetrix microarray data, mouse colorectal cancer grown in non-adipose or white adipose environment This paper GEO:GSE113507 Affymetrix microarray data, mouse colorectal cancer grown in healthy liver or fatty liver with or without antiangiogenic treatment This paper GEO:GSE113508 Experimental Models: Cell Lines MC38 murine colon adenocarcinoma Dr. Rubén Hernández, Center for Applied Medical Research, University of Navarra, Spain N/A Hepa1-6 murine hepatocellular carcinoma ATCC CRL-1830 PancO2 murine pancreatic ductal adenocarcinoma Dr. Maximilian Schnurr, Munich University, Germany N/A Experimental Models: Organisms/Strains Mouse: C57BL/6NJ Jackson Laboratory RRID:IMSR_JAX:005304 Mouse: CB17/Icr-Prkdcscid/IcrCrl Charles River RRID:IMSR_CRL:236 Oligonucleotides qRT-PCR primers.

Techniques: Imaging

Journal: Cell metabolism

Article Title: Cancer Lipid Metabolism Confers Antiangiogenic Drug Resistance.

doi: 10.1016/j.cmet.2018.05.005

Figure Lengend Snippet: Figure 6. Blocking CPT1 Enhances AAD-Mediated Anti-tumor Effects (A and F) shRNA-Cpt1- and control-vehicle-transfected CRC (A) or HCC (F) tumor-bearing mice received NIIgG and anti-VEGF treatment. Upper panels: representative tumors. Arrows point to tumors in each group. Middle panels: extravasation of 70-kDa dextran (green). CD31+ blood vessels (red). Arrowheads indicate leaked dextran signals. Lower panels: perfusion of 2,000-kDa dextran (green). CD31+ blood vessels (red). Arrows indicate perfused tumor vessels. Bar represents 100 mm. (B and G) Immunohistochemical analysis of Ki67+ proliferating cells and activated caspase-3+ apoptotic cells in CRC (B) or HCC (G). Arrows and arrowheads point to proliferating and apoptotic cells, respectively. Bar represents 100 mm. (C and H) Quantification of tumor volumes of various CRC (C) or HCC (H) groups (n = 3–5 animals per group). (D and I) Quantification of CD31+ tumor vessels (n = 9 random fields per group), extravasated 70-kDa dextran signals (n = 9 random fields per group), and perfusion of 2,000-kDa dextran (n = 9 random fields per group) in CRC (D) or HCC (I). (E and J) Quantification of Ki67+ (n = 6 random fields per group) and cleaved caspase-3+ signals (n = 6 random fields per group) in CRC (E) or HCC (J). *p < 0.05; **p < 0.01; ***p < 0.001. NS, not significant. Data presented as means ± SEM. See also Figure S6.

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Chemicals, Peptides, and Recombinant Proteins Etomoxir Dr. Wolf-BioScience N/A MTT Sigma-Aldrich Cat# M5655 Clodronate liposomes FormuMax Cat# F70101C-N Control Liposomes FormuMax Cat# F70101-N Proteinase inhibitor cocktail Sigma-Aldrich Cat# P8340 Phosphatase inhibitor cocktail Cell Signaling Cat# 5870 Bodipy 558/568 C12 Invitrogen Cat# D-3835 D-luciferin PerkinElmer Cat# 122799 Critical Commercial Assays Cpt1 shRNA lentiviral particles Santa Cruz Biotechnology Cat# sc-40377-V Mycoplasma detection kit Lonza Cat# LT07-318 Pimonidazole Hypoxyprobe Cat# HP6-x cDNA Synthesis Kit Thermo Scientific Cat# K1632 Fast SYBR Green Master Mix Applied Biosystems Cat# 4385612 ATP assay kit Abnova Cat# KA0806 NEFA-HR(2) Assay Reagent 1 Wako Chemicals Cat# 434-91795 NEFA-HR(2) Assay Reagent 2 Wako Chemicals Cat# 434-91995 NEFA-HR(2) Assay Standard Wako Chemicals Cat# 270-77000 2000-kDa-lysinated fluorescein-labeled dextran Invitrogen Cat# D7137 2000-kDa-lysinated tetramethylrhodamine-labeled dextran Invitrogen Cat# D7139 70-kDa-lysinated fluorescein-labeled dextran Invitrogen Cat# D1822 70-kDa-lysinated tetramethylrhodamine-labeled dextran Invitrogen Cat# D1818 GeneJET RNA Purification Kit Thermo Scientific Cat# K0732 Deposited Data Affymetrix microarray data, mouse colorectal cancer grown in non-adipose or white adipose environment This paper GEO:GSE113507 Affymetrix microarray data, mouse colorectal cancer grown in healthy liver or fatty liver with or without antiangiogenic treatment This paper GEO:GSE113508 Experimental Models: Cell Lines MC38 murine colon adenocarcinoma Dr. Rubén Hernández, Center for Applied Medical Research, University of Navarra, Spain N/A Hepa1-6 murine hepatocellular carcinoma ATCC CRL-1830 PancO2 murine pancreatic ductal adenocarcinoma Dr. Maximilian Schnurr, Munich University, Germany N/A Experimental Models: Organisms/Strains Mouse: C57BL/6NJ Jackson Laboratory RRID:IMSR_JAX:005304 Mouse: CB17/Icr-Prkdcscid/IcrCrl Charles River RRID:IMSR_CRL:236 Oligonucleotides qRT-PCR primers.

Techniques: Blocking Assay, shRNA, Control, Transfection, Immunohistochemical staining

Journal: Developmental cell

Article Title: CCPG1 Is a Non-canonical Autophagy Cargo Receptor Essential for ER-Phagy and Pancreatic ER Proteostasis.

doi: 10.1016/j.devcel.2017.11.024

Figure Lengend Snippet: Figure 1. CCPG1 Is an LIR Motif-Containing Interactor of Human ATG8 Orthologs (A) Schematic of CCPG1 structure (NTD, N-terminal amino acids 1–230; TM, transmembrane anchor). (B) GST or GST fusions of ATG8 orthologs (LC3B, LC3C, and GABARAP) were used in affinity precipitation (AP) of transfected myc-CCPG1 from HEK293 cells. (C) GST or GST-GABARAP (mtLDS, LIR-docking site mutant) were used in AP of transfected myc-CCPG1 NTD from HEK293 cells.

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER pdcDNA 6x myc CCPG1 Human CCPG1 1-757 This paper N/A pdcDNA 6x myc CCPG1 mtFIR1 S22A D23A I24A E25A Human CCPG1 1-757 This paper N/A pdcDNA 6x myc CCPG1 mtFIR2 S104A D105A I106A L109A Human CCPG1 1-757 This paper N/A pdcDNA 6x myc CCPG1 mtFIR1+2 S22A D23A I24A E25A S104A D105A I106A L109A Human CCPG1 1-757 This paper N/A pdcDNA 6x myc CCPG1 NTD CCPG1 Human CCPG1 1-230 This paper N/A pdcDNA 6x myc CCPG1 NTD Human CCPG1 1-230 with internal deletions or truncated from C-terminus, as indicated in main text This paper N/A pdcDNA FLAG-FIP200 Human FIP200 1279-1594 This paper N/A pEGFP-C1 Clontech # 6084-1 pEGFP-CCPG1 CCPG1 Human CCPG1 1-757 This paper N/A pEGFP-CCPG1 mtLIR W14A I17A Human CCPG1 1-757 This paper N/A pEGFP-CCPG1 mtFIR1+2 S22A D23A I24A E25A S104A D105A I106A L109A Human CCPG1 1-757 This paper N/A pEGFP-CCPG1 mtLIR + mtFIR1+2 W14A I17A S22A D23A I24A E25A S104A D105A I106A L109A Human CCPG1 1-757 This paper N/A pEGFP-CCPG1 NTD Human CCPG11-230 This paper N/A pEGFP-CCPG1 DNTD Human CCPG1 231-757 This paper N/A pmCherry-ER-3 A gift from Michael Davidson, MagLab, USA Addgene plasmid # 55041 pMXs-puro GFP-DFCP1 A gift from Noboru Mizushima, Tokyo medical and dental University, Japan (Itakura and Mizushima, 2010) Addgene plasmid # 38269 pRevTRE EGFP Clontech # 6137-1 pRevTRE GFP-CCPG1 Human CCPG1 1-757 This paper N/A pRevTRE GFP-CCPG1 mtLIR W14A I17A Human CCPG1 1-757 This paper N/A pRevTRE GFP-CCPG1 mtFIR1+2 S22A D23A I24A E25A S104A D105A I106A L109A Human CCPG1 1-757 This paper N/A pSpCas9(BB)-2A-Puro (PX45) v2.0 A gift from Feng Zhang, Broad Institute, USA (Ran et al., 2013) Addgene plasmid # 62988 (Continued on next page) Developmental Cell 44, 217–232.e1–e11, January 22, 2018 e5

Techniques: Transfection, Mutagenesis

Journal: Developmental cell

Article Title: CCPG1 Is a Non-canonical Autophagy Cargo Receptor Essential for ER-Phagy and Pancreatic ER Proteostasis.

doi: 10.1016/j.devcel.2017.11.024

Figure Lengend Snippet: Figure 2. CCPG1 Is a FIP200-Interacting Protein (A) A549 NTAP (FLAG-HA)-CCPG1 cells were immunoprecipitated for tagged CCPG1 using anti-HA antibody and immunoprecipitates subjected to LC-MS/MS and CompPASS analysis (see the STAR Methods and Table S1). Interacting proteins at a cut-off of WDN score 0.8 are shown here. (B) A549 cells stably expressing NTAP empty vector () or NTAP-CCPG1 (+) were immunoprecipitated for tagged CCPG1 with anti-FLAG beads and im- munoblotted for indicated proteins. (C) A549 cells were EBSS starved or left untreated for 1 hr, prior to lysis and endogenous immunoprecipitation of CCPG1 and subsequent immunoblotting (IgG, negative control IgG). (D) HEK293 cells were transfected with FLAG-FIP200 and indicated variants of full-length (FL) GFP-CCPG1 (DNTD, amino acids 231–757). Immunoprecipitation was performed with GFP-Trap and immunoblotting performed with indicated antibodies. (E) Recombinant FIP200 was incubated with either glutathione Sepharose beads alone, or with pre-purified GST or GST-CCPG1 NTD bound beads. Affinity precipitation (AP) followed by immunoblotting was then performed to assess direct interaction. See also Figure S1 and Table S1.

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER pdcDNA 6x myc CCPG1 Human CCPG1 1-757 This paper N/A pdcDNA 6x myc CCPG1 mtFIR1 S22A D23A I24A E25A Human CCPG1 1-757 This paper N/A pdcDNA 6x myc CCPG1 mtFIR2 S104A D105A I106A L109A Human CCPG1 1-757 This paper N/A pdcDNA 6x myc CCPG1 mtFIR1+2 S22A D23A I24A E25A S104A D105A I106A L109A Human CCPG1 1-757 This paper N/A pdcDNA 6x myc CCPG1 NTD CCPG1 Human CCPG1 1-230 This paper N/A pdcDNA 6x myc CCPG1 NTD Human CCPG1 1-230 with internal deletions or truncated from C-terminus, as indicated in main text This paper N/A pdcDNA FLAG-FIP200 Human FIP200 1279-1594 This paper N/A pEGFP-C1 Clontech # 6084-1 pEGFP-CCPG1 CCPG1 Human CCPG1 1-757 This paper N/A pEGFP-CCPG1 mtLIR W14A I17A Human CCPG1 1-757 This paper N/A pEGFP-CCPG1 mtFIR1+2 S22A D23A I24A E25A S104A D105A I106A L109A Human CCPG1 1-757 This paper N/A pEGFP-CCPG1 mtLIR + mtFIR1+2 W14A I17A S22A D23A I24A E25A S104A D105A I106A L109A Human CCPG1 1-757 This paper N/A pEGFP-CCPG1 NTD Human CCPG11-230 This paper N/A pEGFP-CCPG1 DNTD Human CCPG1 231-757 This paper N/A pmCherry-ER-3 A gift from Michael Davidson, MagLab, USA Addgene plasmid # 55041 pMXs-puro GFP-DFCP1 A gift from Noboru Mizushima, Tokyo medical and dental University, Japan (Itakura and Mizushima, 2010) Addgene plasmid # 38269 pRevTRE EGFP Clontech # 6137-1 pRevTRE GFP-CCPG1 Human CCPG1 1-757 This paper N/A pRevTRE GFP-CCPG1 mtLIR W14A I17A Human CCPG1 1-757 This paper N/A pRevTRE GFP-CCPG1 mtFIR1+2 S22A D23A I24A E25A S104A D105A I106A L109A Human CCPG1 1-757 This paper N/A pSpCas9(BB)-2A-Puro (PX45) v2.0 A gift from Feng Zhang, Broad Institute, USA (Ran et al., 2013) Addgene plasmid # 62988 (Continued on next page) Developmental Cell 44, 217–232.e1–e11, January 22, 2018 e5

Techniques: Immunoprecipitation, Liquid Chromatography with Mass Spectroscopy, Stable Transfection, Expressing, Plasmid Preparation, Lysis, Western Blot, Negative Control, Transfection, Recombinant, Incubation

Journal: Developmental cell

Article Title: CCPG1 Is a Non-canonical Autophagy Cargo Receptor Essential for ER-Phagy and Pancreatic ER Proteostasis.

doi: 10.1016/j.devcel.2017.11.024

Figure Lengend Snippet: Figure 3. Identification of a Linear Peptide Motif in CCPG1 for Binding to FIP200 C-Terminal Region (A) A 15-mer peptide array (peptides 1–55) was probed with recombinant FIP200. Bound FIP200 was detected by indirect immunodetection. Peptide sequences corresponding to binding regions A–C are shown below the array. (B and C) HEK293 cells were transfected with FLAG-FIP200 and indicated myc-tagged deletions or truncations of CCPG1 NTD prior to anti-myc immunopre- cipitation and immunoblotting (EV, empty vector). (D) Sequence alignment of the region from amino acids 97 to 118 of human CCPG1 against vertebrate orthologs (upper) or of regions amino acids 99–113 and 17– 31 of human CCPG1 (lower). Conserved S/T and acidic residues are blue, hydrophobic residues are red. Asterisks indicate evolutionary conservation of residues. Black boxes indicate residues identical between FIR1 and FIR2. (legend continued on next page)

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER pdcDNA 6x myc CCPG1 Human CCPG1 1-757 This paper N/A pdcDNA 6x myc CCPG1 mtFIR1 S22A D23A I24A E25A Human CCPG1 1-757 This paper N/A pdcDNA 6x myc CCPG1 mtFIR2 S104A D105A I106A L109A Human CCPG1 1-757 This paper N/A pdcDNA 6x myc CCPG1 mtFIR1+2 S22A D23A I24A E25A S104A D105A I106A L109A Human CCPG1 1-757 This paper N/A pdcDNA 6x myc CCPG1 NTD CCPG1 Human CCPG1 1-230 This paper N/A pdcDNA 6x myc CCPG1 NTD Human CCPG1 1-230 with internal deletions or truncated from C-terminus, as indicated in main text This paper N/A pdcDNA FLAG-FIP200 Human FIP200 1279-1594 This paper N/A pEGFP-C1 Clontech # 6084-1 pEGFP-CCPG1 CCPG1 Human CCPG1 1-757 This paper N/A pEGFP-CCPG1 mtLIR W14A I17A Human CCPG1 1-757 This paper N/A pEGFP-CCPG1 mtFIR1+2 S22A D23A I24A E25A S104A D105A I106A L109A Human CCPG1 1-757 This paper N/A pEGFP-CCPG1 mtLIR + mtFIR1+2 W14A I17A S22A D23A I24A E25A S104A D105A I106A L109A Human CCPG1 1-757 This paper N/A pEGFP-CCPG1 NTD Human CCPG11-230 This paper N/A pEGFP-CCPG1 DNTD Human CCPG1 231-757 This paper N/A pmCherry-ER-3 A gift from Michael Davidson, MagLab, USA Addgene plasmid # 55041 pMXs-puro GFP-DFCP1 A gift from Noboru Mizushima, Tokyo medical and dental University, Japan (Itakura and Mizushima, 2010) Addgene plasmid # 38269 pRevTRE EGFP Clontech # 6137-1 pRevTRE GFP-CCPG1 Human CCPG1 1-757 This paper N/A pRevTRE GFP-CCPG1 mtLIR W14A I17A Human CCPG1 1-757 This paper N/A pRevTRE GFP-CCPG1 mtFIR1+2 S22A D23A I24A E25A S104A D105A I106A L109A Human CCPG1 1-757 This paper N/A pSpCas9(BB)-2A-Puro (PX45) v2.0 A gift from Feng Zhang, Broad Institute, USA (Ran et al., 2013) Addgene plasmid # 62988 (Continued on next page) Developmental Cell 44, 217–232.e1–e11, January 22, 2018 e5

Techniques: Binding Assay, Peptide Microarray, Recombinant, Immunodetection, Transfection, Western Blot, Plasmid Preparation, Sequencing

Journal: Developmental cell

Article Title: CCPG1 Is a Non-canonical Autophagy Cargo Receptor Essential for ER-Phagy and Pancreatic ER Proteostasis.

doi: 10.1016/j.devcel.2017.11.024

Figure Lengend Snippet: Figure 4. CCPG1 Is Recruited into Autophagosomes from the ER (A) A549 cells were transfected with siCtrl or siCCPG1 and, at 24 hr post-transfection, either left untreated or starved for 1 hr in EBSS, then stained for endogenous CCPG1. Cells with CCPG1 foci were scored (n = 3, ± SEM, *p < 0.05, two-tailed paired sample t tests). Scale bar, 20 mm. (legend continued on next page)

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER pdcDNA 6x myc CCPG1 Human CCPG1 1-757 This paper N/A pdcDNA 6x myc CCPG1 mtFIR1 S22A D23A I24A E25A Human CCPG1 1-757 This paper N/A pdcDNA 6x myc CCPG1 mtFIR2 S104A D105A I106A L109A Human CCPG1 1-757 This paper N/A pdcDNA 6x myc CCPG1 mtFIR1+2 S22A D23A I24A E25A S104A D105A I106A L109A Human CCPG1 1-757 This paper N/A pdcDNA 6x myc CCPG1 NTD CCPG1 Human CCPG1 1-230 This paper N/A pdcDNA 6x myc CCPG1 NTD Human CCPG1 1-230 with internal deletions or truncated from C-terminus, as indicated in main text This paper N/A pdcDNA FLAG-FIP200 Human FIP200 1279-1594 This paper N/A pEGFP-C1 Clontech # 6084-1 pEGFP-CCPG1 CCPG1 Human CCPG1 1-757 This paper N/A pEGFP-CCPG1 mtLIR W14A I17A Human CCPG1 1-757 This paper N/A pEGFP-CCPG1 mtFIR1+2 S22A D23A I24A E25A S104A D105A I106A L109A Human CCPG1 1-757 This paper N/A pEGFP-CCPG1 mtLIR + mtFIR1+2 W14A I17A S22A D23A I24A E25A S104A D105A I106A L109A Human CCPG1 1-757 This paper N/A pEGFP-CCPG1 NTD Human CCPG11-230 This paper N/A pEGFP-CCPG1 DNTD Human CCPG1 231-757 This paper N/A pmCherry-ER-3 A gift from Michael Davidson, MagLab, USA Addgene plasmid # 55041 pMXs-puro GFP-DFCP1 A gift from Noboru Mizushima, Tokyo medical and dental University, Japan (Itakura and Mizushima, 2010) Addgene plasmid # 38269 pRevTRE EGFP Clontech # 6137-1 pRevTRE GFP-CCPG1 Human CCPG1 1-757 This paper N/A pRevTRE GFP-CCPG1 mtLIR W14A I17A Human CCPG1 1-757 This paper N/A pRevTRE GFP-CCPG1 mtFIR1+2 S22A D23A I24A E25A S104A D105A I106A L109A Human CCPG1 1-757 This paper N/A pSpCas9(BB)-2A-Puro (PX45) v2.0 A gift from Feng Zhang, Broad Institute, USA (Ran et al., 2013) Addgene plasmid # 62988 (Continued on next page) Developmental Cell 44, 217–232.e1–e11, January 22, 2018 e5

Techniques: Transfection, Staining, Two Tailed Test

Journal: Developmental cell

Article Title: CCPG1 Is a Non-canonical Autophagy Cargo Receptor Essential for ER-Phagy and Pancreatic ER Proteostasis.

doi: 10.1016/j.devcel.2017.11.024

Figure Lengend Snippet: Figure 5. CCPG1 Is a UPR-Inducible Gene that Remodels the ER (A) A549 cells were treated with indicated ER stressors for 16 hr (Tun, tunicamycin, 2.5 mg/mL and Thaps, thapsigargin, 0.5 mM). qRT-PCR was performed for CCPG1 (n = 3, ± SEM, *p < 0.05, one-way ANOVA followed by Tukey’s post-hoc test). (B) HeLa cells were treated with indicated ER stressors (DTT, 0.5 or 2 mM, and Tun at 1 or 2.5 mg/mL, or Thaps at 0.5 mM) for 16 hr and then immunoblotted.

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER pdcDNA 6x myc CCPG1 Human CCPG1 1-757 This paper N/A pdcDNA 6x myc CCPG1 mtFIR1 S22A D23A I24A E25A Human CCPG1 1-757 This paper N/A pdcDNA 6x myc CCPG1 mtFIR2 S104A D105A I106A L109A Human CCPG1 1-757 This paper N/A pdcDNA 6x myc CCPG1 mtFIR1+2 S22A D23A I24A E25A S104A D105A I106A L109A Human CCPG1 1-757 This paper N/A pdcDNA 6x myc CCPG1 NTD CCPG1 Human CCPG1 1-230 This paper N/A pdcDNA 6x myc CCPG1 NTD Human CCPG1 1-230 with internal deletions or truncated from C-terminus, as indicated in main text This paper N/A pdcDNA FLAG-FIP200 Human FIP200 1279-1594 This paper N/A pEGFP-C1 Clontech # 6084-1 pEGFP-CCPG1 CCPG1 Human CCPG1 1-757 This paper N/A pEGFP-CCPG1 mtLIR W14A I17A Human CCPG1 1-757 This paper N/A pEGFP-CCPG1 mtFIR1+2 S22A D23A I24A E25A S104A D105A I106A L109A Human CCPG1 1-757 This paper N/A pEGFP-CCPG1 mtLIR + mtFIR1+2 W14A I17A S22A D23A I24A E25A S104A D105A I106A L109A Human CCPG1 1-757 This paper N/A pEGFP-CCPG1 NTD Human CCPG11-230 This paper N/A pEGFP-CCPG1 DNTD Human CCPG1 231-757 This paper N/A pmCherry-ER-3 A gift from Michael Davidson, MagLab, USA Addgene plasmid # 55041 pMXs-puro GFP-DFCP1 A gift from Noboru Mizushima, Tokyo medical and dental University, Japan (Itakura and Mizushima, 2010) Addgene plasmid # 38269 pRevTRE EGFP Clontech # 6137-1 pRevTRE GFP-CCPG1 Human CCPG1 1-757 This paper N/A pRevTRE GFP-CCPG1 mtLIR W14A I17A Human CCPG1 1-757 This paper N/A pRevTRE GFP-CCPG1 mtFIR1+2 S22A D23A I24A E25A S104A D105A I106A L109A Human CCPG1 1-757 This paper N/A pSpCas9(BB)-2A-Puro (PX45) v2.0 A gift from Feng Zhang, Broad Institute, USA (Ran et al., 2013) Addgene plasmid # 62988 (Continued on next page) Developmental Cell 44, 217–232.e1–e11, January 22, 2018 e5

Techniques: Quantitative RT-PCR

Journal: Developmental cell

Article Title: CCPG1 Is a Non-canonical Autophagy Cargo Receptor Essential for ER-Phagy and Pancreatic ER Proteostasis.

doi: 10.1016/j.devcel.2017.11.024

Figure Lengend Snippet: Figure 6. Defective Proteostasis in the Pancreas of Ccpg1 Hypomorphic Mice (A and B) Whole pancreata from littermate 6-week-old WT (+/+) or Ccpg1 hypomorphic (GT/GT) mice were immunoblotted for CCPG1 or subjected to RNA extraction and qRT-PCR for Ccpg1 (n = 3 pairs, ± SEM, ***p < 0.001, two-tailed t test). (C and D) Fifty mg of whole pancreata from littermate pairs of 6-week-old WT and Ccpg1 hypomorphic mice were homogenized in SDS. Insoluble protein was pelleted, washed and extracted in 8 M urea +10 mM DTT. Pellet samples were normalized according to protein concentration in the soluble fraction and subjected to label-free LC-MS/MS quantification. A median absolute deviation analysis is presented as a heatmap here to show species changing significantly between pairs of mice (pairs joined by connecting brackets). Secretory enzymes are in red, ER luminal chaperones/oxidoreductases are in blue. (E and F) Detergent soluble and insoluble samples prepared as above were immunoblotted and ratios of insoluble to soluble protein species obtained via densitometry (n = 3 pairs, ± SEM, *p < 0.05, **p < 0.01, ***p < 0.001, two-tailed t tests). See also Figure S5 and Table S2.

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER pdcDNA 6x myc CCPG1 Human CCPG1 1-757 This paper N/A pdcDNA 6x myc CCPG1 mtFIR1 S22A D23A I24A E25A Human CCPG1 1-757 This paper N/A pdcDNA 6x myc CCPG1 mtFIR2 S104A D105A I106A L109A Human CCPG1 1-757 This paper N/A pdcDNA 6x myc CCPG1 mtFIR1+2 S22A D23A I24A E25A S104A D105A I106A L109A Human CCPG1 1-757 This paper N/A pdcDNA 6x myc CCPG1 NTD CCPG1 Human CCPG1 1-230 This paper N/A pdcDNA 6x myc CCPG1 NTD Human CCPG1 1-230 with internal deletions or truncated from C-terminus, as indicated in main text This paper N/A pdcDNA FLAG-FIP200 Human FIP200 1279-1594 This paper N/A pEGFP-C1 Clontech # 6084-1 pEGFP-CCPG1 CCPG1 Human CCPG1 1-757 This paper N/A pEGFP-CCPG1 mtLIR W14A I17A Human CCPG1 1-757 This paper N/A pEGFP-CCPG1 mtFIR1+2 S22A D23A I24A E25A S104A D105A I106A L109A Human CCPG1 1-757 This paper N/A pEGFP-CCPG1 mtLIR + mtFIR1+2 W14A I17A S22A D23A I24A E25A S104A D105A I106A L109A Human CCPG1 1-757 This paper N/A pEGFP-CCPG1 NTD Human CCPG11-230 This paper N/A pEGFP-CCPG1 DNTD Human CCPG1 231-757 This paper N/A pmCherry-ER-3 A gift from Michael Davidson, MagLab, USA Addgene plasmid # 55041 pMXs-puro GFP-DFCP1 A gift from Noboru Mizushima, Tokyo medical and dental University, Japan (Itakura and Mizushima, 2010) Addgene plasmid # 38269 pRevTRE EGFP Clontech # 6137-1 pRevTRE GFP-CCPG1 Human CCPG1 1-757 This paper N/A pRevTRE GFP-CCPG1 mtLIR W14A I17A Human CCPG1 1-757 This paper N/A pRevTRE GFP-CCPG1 mtFIR1+2 S22A D23A I24A E25A S104A D105A I106A L109A Human CCPG1 1-757 This paper N/A pSpCas9(BB)-2A-Puro (PX45) v2.0 A gift from Feng Zhang, Broad Institute, USA (Ran et al., 2013) Addgene plasmid # 62988 (Continued on next page) Developmental Cell 44, 217–232.e1–e11, January 22, 2018 e5

Techniques: RNA Extraction, Quantitative RT-PCR, Two Tailed Test, Protein Concentration, Liquid Chromatography with Mass Spectroscopy

Journal: Developmental cell

Article Title: CCPG1 Is a Non-canonical Autophagy Cargo Receptor Essential for ER-Phagy and Pancreatic ER Proteostasis.

doi: 10.1016/j.devcel.2017.11.024

Figure Lengend Snippet: Figure 7. Loss of Cell Polarization and ER Homeostasis, and Consequent Tissue Injury, in Ccpg1 Hypomorphic Exocrine Pancreata (A) The acinar unit of the exocrine pancreas. Polarized acinar cells secrete condensed enzyme (zymogen) granules into ducts from their apical stores. These enzymes are initially synthesized in the expansive rough ER (rER), which occupies the basolateral regions of the cell. (B) CARS imaging or immunohistochemical staining for the ER (protein disulfide isomerase, PDI) in pancreatic tissue from 6-week-old littermate WT (+/+) or Ccpg1 hypomorphic (GT/GT) mice. Punctate CARS signals indicate protein or lipid inclusions. Scale bars, 20 mm. (C) Transmission electron microscopy (TEM) of pancreata from 6-week-old littermate pairs. Scale bar, 5 mm. Analysis of percent cytosolic area occupied by osmophilic protein granules was performed in ImageJ (n = 4 pairs, ± SEM, *p < 0.05, two-tailed t test). (D) High magnification TEM of a Ccpg1 hypomorphic mouse reveals that the rER is distended and many supernumerary inclusions are in fact intracisternal granule-like structures (arrows in zoomed inset). Scale bar, 1 mm.

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER pdcDNA 6x myc CCPG1 Human CCPG1 1-757 This paper N/A pdcDNA 6x myc CCPG1 mtFIR1 S22A D23A I24A E25A Human CCPG1 1-757 This paper N/A pdcDNA 6x myc CCPG1 mtFIR2 S104A D105A I106A L109A Human CCPG1 1-757 This paper N/A pdcDNA 6x myc CCPG1 mtFIR1+2 S22A D23A I24A E25A S104A D105A I106A L109A Human CCPG1 1-757 This paper N/A pdcDNA 6x myc CCPG1 NTD CCPG1 Human CCPG1 1-230 This paper N/A pdcDNA 6x myc CCPG1 NTD Human CCPG1 1-230 with internal deletions or truncated from C-terminus, as indicated in main text This paper N/A pdcDNA FLAG-FIP200 Human FIP200 1279-1594 This paper N/A pEGFP-C1 Clontech # 6084-1 pEGFP-CCPG1 CCPG1 Human CCPG1 1-757 This paper N/A pEGFP-CCPG1 mtLIR W14A I17A Human CCPG1 1-757 This paper N/A pEGFP-CCPG1 mtFIR1+2 S22A D23A I24A E25A S104A D105A I106A L109A Human CCPG1 1-757 This paper N/A pEGFP-CCPG1 mtLIR + mtFIR1+2 W14A I17A S22A D23A I24A E25A S104A D105A I106A L109A Human CCPG1 1-757 This paper N/A pEGFP-CCPG1 NTD Human CCPG11-230 This paper N/A pEGFP-CCPG1 DNTD Human CCPG1 231-757 This paper N/A pmCherry-ER-3 A gift from Michael Davidson, MagLab, USA Addgene plasmid # 55041 pMXs-puro GFP-DFCP1 A gift from Noboru Mizushima, Tokyo medical and dental University, Japan (Itakura and Mizushima, 2010) Addgene plasmid # 38269 pRevTRE EGFP Clontech # 6137-1 pRevTRE GFP-CCPG1 Human CCPG1 1-757 This paper N/A pRevTRE GFP-CCPG1 mtLIR W14A I17A Human CCPG1 1-757 This paper N/A pRevTRE GFP-CCPG1 mtFIR1+2 S22A D23A I24A E25A S104A D105A I106A L109A Human CCPG1 1-757 This paper N/A pSpCas9(BB)-2A-Puro (PX45) v2.0 A gift from Feng Zhang, Broad Institute, USA (Ran et al., 2013) Addgene plasmid # 62988 (Continued on next page) Developmental Cell 44, 217–232.e1–e11, January 22, 2018 e5

Techniques: Synthesized, Imaging, Immunohistochemical staining, Staining, Transmission Assay, Electron Microscopy, Two Tailed Test

Journal: Proceedings of the National Academy of Sciences of the United States of America

Article Title: KLHL22 maintains PD-1 homeostasis and prevents excessive T cell suppression

doi: 10.1073/pnas.2004570117

Figure Lengend Snippet: KLHL22 is a major PD-1–associated protein. (A) PD-1–associated proteins in Jurkat cells were identified by MS. Jurkat cells stably expressing PD-1–FLAG were purified with FLAG-M2 beads and analyzed by MS. Jurkat cells was stimulated by PMA (50 ng/mL) and ionomycin (1 μM) for 12 h. The table lists the selected proteins identified by MS. The full protein list is provided in Dataset S1. (B) PD-1–associated proteins in HEK293T cells were identified by TAP/MS. HEK293T cells stably expressing PD-1–SFB were purified by TAP/MS. The table lists the selected proteins identified by MS. The full protein list is provided in Dataset S2. (C and D) Venn diagram showing the overlap of two MS results. Proteins appearing in the MS results of both the Jurkat PD-1–FLAG cells and HEK293T PD-1–SFB cells. The results from the overlap shown in C are presented in a 2D graph in D. The full protein list is provided in Dataset S3. (E) 6-Kelch repeats in KLHL22 are required for the interaction between KLHL22 and PD-1. HEK293T cells were cotransfected with untagged PD-1 (PD-1 without an artificial tag) and PD-L1-SFB, SFB-KLHL22, or SFB-KLHL22Δ6K. The cell lysates were subjected to pull-down assays with S protein Sepharose and immunoblotted with the indicated antibodies. (F) HEK293T cells were cotransfected with PD-1–SFB and Myc-KLHL22, Myc-KLHL22Δ6K, Myc-KLHL9, or Myc-KLHL13. The cell lysates were subjected to pull-down assays with S-protein Sepharose and immunoblotted with the indicated antibodies. (G) Lysates of Jurkat cells stably expressing PD-1–FLAG were immunoprecipitated with FLAG-M2 beads or protein G beads with IgG and subjected to immunoblotting with the indicated antibodies. Jurkat cells were stimulated by PMA (50 ng/mL) and ionomycin (1 μM) for 12 h. (H) The endogenous interaction of PD-1 and KLHL22 in healthy human PBMCs using KLHL22 antibody pull-down. Human healthy PBMCs lysates were immunoprecipitated with an anti-KLHL22 antibody or IgG and subjected to immunoblotting with the indicated antibodies. PBMCs were stimulated by anti-CD3 (1 μg/mL) and anti-CD28 (2 μg/mL) for 12 h, 24 h, or 36 h. (I) Endogenous PD-1 associates with endogenous KLHL22 in healthy human PBMCs. Human healthy PBMCs lysates were immunoprecipitated with an anti–PD-1 antibody or IgG and subjected to immunoblotting with the indicated antibodies. PBMCs were stimulated by anti-CD3 (1 μg/mL) or anti-CD3 (1 μg/mL)/anti-CD28 (2 μg/mL) for 24 h. The third group was also treated with PD-1 antibody (2 μg/mL) for 24 h. (J) Endogenous KLHL22 associates with endogenous PD-1 in healthy human PBMCs. CD28 and CTLA4 were tested simultaneously and showed negative results. Human healthy PBMCs lysates were immunoprecipitated with an anti-KLHL22 antibody or IgG and subjected to immunoblotting with the indicated antibodies. PBMCs were stimulated by anti-CD3 (0.5 μg/mL or 1 μg/mL) and anti-CD28 (2 μg/mL) for 24 h.

Article Snippet: The Klhl22 KO mouse was created using a CRISPR/Cas9-mediated genome-editing system from Cyagen Biosciences; exon 4 was selected as the target site.

Techniques: Stable Transfection, Expressing, Purification, Immunoprecipitation, Western Blot

Journal: Proceedings of the National Academy of Sciences of the United States of America

Article Title: KLHL22 maintains PD-1 homeostasis and prevents excessive T cell suppression

doi: 10.1073/pnas.2004570117

Figure Lengend Snippet: Loss of KLHL22 leads to up-regulation of PD-1 at the protein level. (A) Depletion of KLHL22 increases PD-1 expression on the surface of Jurkat cells. Jurkat cells infected with lentivirus containing control or KLHL22-specific shRNA were stimulated with anti-CD3 (1 μg/mL) and anti-CD28 (2 μg/mL) for 24 h and subjected to flow cytometry to measure PD-1 expression on the cell surface. n = 3 biological independent samples, **P < 0.01, ***P < 0.001, unpaired Student’s t test. (B) Knockdown of KLHL22 increases PD-1 expression in HEK293T cells stably expressing PD-1–SFB. HEK293T cells stably expressing PD-1–SFB were infected with lentivirus containing control or KLHL22-specific shRNA and subjected to immunoblotting to detect PD-1 expression. (C and D) Cell-surface expression of PD-1 is higher in activated CD8+ (C) and CD4+ (D) T cells from Klhl22 KO mice than in those from WT mice. Naïve T cells from WT and Klhl22 KO mice were stimulated with anti-CD3 (1 μg/mL) and anti-CD28 (2 μg/mL) for 24 h. n = 4 mice per group. **P < 0.01, unpaired Student’s t test. (E) Transcription levels of Pdcd1 in CD3+ T cells from WT and Klhl22 KO mice showed no differences. CD3+ T cells were isolated from lymph nodes, and qRT-PCR analysis was used to measure the mRNA level of Pdcd1. n = 3 mice per group; ns, not significant, unpaired Student’s t test. (F) Cell-surface expression levels of LAG-3 in activated CD8+ T cells from WT and Klhl22 KO mice showed no differences. Naïve T cells from WT and Klhl22 KO mice were stimulated with anti-CD3 and anti-CD28 antibodies for 24 h. n = 3 mice per group; ns, not significant, unpaired Student’s t test.

Article Snippet: The Klhl22 KO mouse was created using a CRISPR/Cas9-mediated genome-editing system from Cyagen Biosciences; exon 4 was selected as the target site.

Techniques: Expressing, Infection, Control, shRNA, Flow Cytometry, Knockdown, Stable Transfection, Western Blot, Isolation, Quantitative RT-PCR

Journal: Proceedings of the National Academy of Sciences of the United States of America

Article Title: KLHL22 maintains PD-1 homeostasis and prevents excessive T cell suppression

doi: 10.1073/pnas.2004570117

Figure Lengend Snippet: KLHL22 mediates the degradation of PD-1 before it is transported to the cell surface. (A) Cell-surface levels of PD-1 of CD8+ T cell in activated healthy human PBMCs with or without MG132 treatment were detected by flow cytometry. PBMCs were stimulated with anti-CD3 (1 μg/mL), anti-CD28 (2 μg/mL) and treated with MG132 (1 μM) for indicated hours. n = 3 repeats, *P < 0.05, ***P < 0.001, unpaired Student’s t test. (B) KLHL22 does not localize to the cell membrane in healthy human PBMCs with or without stimulation. PBMCs were incubated in the presence or absence of anti-CD3 (1 μg/mL), anti-CD28 (2 μg/mL), and subjected to immunostaining with KLHL22 antibodies. (Scale bar, 2 μm.) On the right, no significant difference in cell membrane localization of KLHL22 before and after activation. Immunofluorescence staining for KLHL22 was performed in PBMCs. MATLAB was used to identify KLHL22 near membrane location in multiple pictures and quantify the percentage of KLHL22 localization near the cell membrane. ns, not significant, unpaired Student’s t test. (C) Simultaneous treatment with MLN4924 and BFA increased the levels of incompletely glycosylated PD-1. HEK293T cells stably expressing untagged PD-1 were treated with BFA (1 µM), MLN4924 (1 µM), and MG132 (1 µM) as indicated for 12 h. The three arrows on the right side of the figure indicate fully glycosylated PD-1 (top), incompletely glycosylated PD-1 (middle), and newly synthesized PD-1 (bottom). (D) KLHL22 down-regulation leads to more accumulation of incompletely glycosylated PD-1 than fully glycosylated PD-1. The expression level of PD-1 in HEK293T cells subjected to BFA treatment and/or KLHL22 shRNA lentivirus infection was detected. HEK293T cells stably expressing PD-1–SFB were infected with lentivirus containing control or KLHL22-specific shRNA and incubated in the presence or absence of BFA (1 µM, 12 h). Cells were then subjected to immunoblotting with the indicated antibodies. (E) The amount of cytoplasmic PD-1 is higher in CD3+ T cells from Klhl22 KO mice cells than in those from WT mice. The Golgi apparatus was extracted from CD3+ T cells from WT and Klhl22 KO mice and subjected to immunoblotting to detect the protein level of PD-1 in the Golgi apparatus. Na+/K+ ATPase served as a cell membrane marker, whereas GM130 served as a Golgi apparatus marker. (F) KLHL22 has a higher affinity for incompletely glycosylated PD-1 than for fully glycosylated PD-1. HEK293T cells stably expressing untagged PD-1 were transfected with the indicated plasmids in the presence or absence of BFA (1 µM, 12 h), and cell lysates were subjected to pull-down assays with S-protein Sepharose and immunoblotted with the indicated antibodies. (G) PD-1 colocalizes with KLHL22 in the cytoplasm in Jurkat cells. Colocalization of PD-1 and endogenous KLHL22 in Jurkat cells stably expressing PD-1–FLAG was confirmed by immunostaining with anti-KLHL22 and anti-FLAG antibodies. Jurkat cells were stimulated with PMA (50 ng/mL 12 h)/ionomycin (1 µM 12 h) and treated with BFA (1 µM, 6 h). Pearson’s r = 0.76. (Scale bar, 2 μm.) (H) PLA was used to detect the colocalization of PD-1 and endogenous KLHL22 in Jurkat PD-1–FLAG stable cell lines in the presence or absence of BFA (1 µM, 6 h). Using of only one antibody (anti-KLHL22 or anti-FLAG) served as the negative control groups. (Scale bar, 2 μm.)

Article Snippet: The Klhl22 KO mouse was created using a CRISPR/Cas9-mediated genome-editing system from Cyagen Biosciences; exon 4 was selected as the target site.

Techniques: Flow Cytometry, Membrane, Incubation, Immunostaining, Activation Assay, Immunofluorescence, Staining, Stable Transfection, Expressing, Synthesized, shRNA, Infection, Control, Western Blot, Marker, Transfection, Negative Control

Journal: Proceedings of the National Academy of Sciences of the United States of America

Article Title: KLHL22 maintains PD-1 homeostasis and prevents excessive T cell suppression

doi: 10.1073/pnas.2004570117

Figure Lengend Snippet: KLHL22 mediates polyubiquitination-directed degradation of incompletely glycosylated PD-1. (A) PD-1 ubiquitination is inhibited by KLHL22 depletion. Control or KLHL22-specific siRNA was transfected into HEK293T cells stably expressing PD-1–SFB in the presence of MG132 (1 µM 24 h). Cell lysates were subjected to pull-down assays by S-protein Sepharose and immunoblotted with the indicated antibodies. (B) PD-1 ubiquitination is inhibited upon MLN4924 treatment. HEK293T cells stably expressing PD-1–SFB were treated with BFA (1 µM), MLN4924 (1 µM), and MG132 (1 µM) as indicated for 12 h, and cell lysates were subjected to pull-down assays with S-protein Sepharose and immunoblotted with anti-FLAG and antiubiquitin antibodies. (C) Incompletely glycosylated PD-1 is unstable in vivo. PD-1–SFB stable cells were incubated in medium containing 10 μg/mL cycloheximide (CHX) in the presence or absence of BFA (1 µM) for the indicated time. Western blotting was carried out using the indicated antibodies. (D) The KLHL22/CUL3/RBX1 complex ubiquitinates PD-1 in vivo. CUL3, RBX1, and either KLHL22 or KLHL22Δ6K were overexpressed in HEK293T cells stably expressing PD-1–SFB, and cell lysates were subjected to pull-down assays with S-protein Sepharose and immunoblotted with the indicated antibodies. (E) Only 48K ubiquitin can be conjugated to PD-1. For ubiquitination mutants transfected into HEK293T cells stably expressing PD-1–SFB, all lysine’s were mutated to arginine except Lys48 (48K) or Lys63 (63K). Cells were treated with MG132 (1 µM, 24 h). Ubiquitination of PD-1 was detected by immunoblotting with antiubiquitin antibody. Cell lysates were subjected to pull-down assays with S-protein Sepharose and immunoblotted with antiubiquitin and anti-FLAG antibodies. (F) The ubiquitination of PD-1 on K210R and K233R is significantly reduced. PD-1–SFB (WT), PD-1–SFB (K210R), or PD-1–SFB (K233R) was transfected into HEK293T cells treated with BFA (1 µM), MLN4924 (1 µM) and MG132 (1 µM) as indicated for 12 h. The resulting cell lysates were subjected to pull-down assays with S-protein Sepharose and immunoblotted with the indicated antibodies.

Article Snippet: The Klhl22 KO mouse was created using a CRISPR/Cas9-mediated genome-editing system from Cyagen Biosciences; exon 4 was selected as the target site.

Techniques: Ubiquitin Proteomics, Control, Transfection, Stable Transfection, Expressing, In Vivo, Incubation, Western Blot

Journal: Proceedings of the National Academy of Sciences of the United States of America

Article Title: KLHL22 maintains PD-1 homeostasis and prevents excessive T cell suppression

doi: 10.1073/pnas.2004570117

Figure Lengend Snippet: KLHL22 regulates T cell antitumor immunity. (A–C) Klhl22 KO mice showed faster tumor progression. WT and Klhl22 KO mice were subcutaneously injected with B16F10 melanoma cells. Tumor growth was monitored over a period of 17 d. The tumors were isolated from mice killed on day 17 and measured. n = 7 mice per group, ***P < 0.001, (B) two-way ANOVA, (C) unpaired Student’s t test. (D) Klhl22 KO mice inoculated with tumors have a shorter survival time. WT mice and Klhl22 KO mice were subcutaneously injected with B16F10 melanoma cells, and the survival was assessed in WT and Klhl22 KO mice. n = 7 mice per group, *P < 0.05, log-rank (Mantel–Cox) test. (E and F) The CD8+/CD4+ ratio (E) and regulatory T cell ratio (F) of tumor-infiltrating T cells were not significantly different in tumor tissues from WT mice and those from Klhl22 KO mice. Tumor-infiltrating T cells from WT and Klhl22 KO mice were isolated on day 17 and subjected to flow cytometry to measure the CD4/CD8 ratio and T cell ratio. n = 7 mice per group; ns, not significant, unpaired Student’s t test. (G) PD-1 expression in tumor-infiltrating T cells from Klhl22 KO mice is significantly higher than that in cells from WT mice. Tumor-infiltrating T cells from WT and Klhl22 KO mice were isolated on day 17 and subjected to flow cytometry. n = 7 mice per group, *P < 0.05, **P < 0.01, ***P < 0.001, unpaired Student’s t test. (H–J) Cytokine production by tumor-infiltrating CD8+ and CD4+ T cells from Klhl22 KO mice is inhibited. Tumor-infiltrating T cells from WT and Klhl22 KO mice were isolated on day 17 and subjected to flow cytometry. n = 7 or 6 mice per group, *P < 0.05, **P < 0.01, unpaired Student’s t test. (K) The proliferation of tumor-infiltrating CD8+ T cells was decreased in Klhl22 KO mice. Tumor-infiltrating T cells from WT and Klhl22 KO mice were isolated on day 17 and subjected to flow cytometry. n = 6 mice per group, *P < 0.05, **P < 0.01, unpaired Student’s t test. (L and M) PD-1 antibody treatment dramatically diminished the difference in tumor growth between WT and KO mice where there was no statistically significant difference. WT and Klhl22 mice were subcutaneously injected with B16F10 melanoma cells. Tumor growth was monitored over a period of 18 d. Mice were intraperitoneally injected with PBS or anti–PD-1 (RMP1-14, 200 μg per mouse, dissolved in PBS) every 3 d (three times in total) 8 d after B16F10 inoculation and tumor sizes were recorded every 2 d afterward (n = 6). ns, not significant, ***P < 0.001, two-way ANOVA.

Article Snippet: The Klhl22 KO mouse was created using a CRISPR/Cas9-mediated genome-editing system from Cyagen Biosciences; exon 4 was selected as the target site.

Techniques: Injection, Isolation, Flow Cytometry, Expressing

Journal: Proceedings of the National Academy of Sciences of the United States of America

Article Title: KLHL22 maintains PD-1 homeostasis and prevents excessive T cell suppression

doi: 10.1073/pnas.2004570117

Figure Lengend Snippet: T cell activation and the tumor microenvironment regulate KLHL22 expression. (A) The transcription levels of Klhl22 in mouse CD3+ T cells increase dramatically upon T cell activation. CD3+ T cells were isolated from the lymph nodes of C57BL6 WT mice and stimulated with anti-CD3 (2 µg/mL) and/or anti-CD28 (4 µg/mL); the cells were then subjected to total RNA extraction and qRT-PCR analysis. n = 3 independent biological samples per group, **P < 0.01, unpaired Student’s t test. (B) The transcription levels of KLHL22 increase over time in activated Jurkat cells. Jurkat cells were stimulated with PMA (50 µg/mL) and ionomycin (1 µM) for the indicated time and then subjected to total RNA extraction and qRT-PCR analysis. n = 3 independent biological samples per group; ns, not significant, *P < 0.05, unpaired Student’s t test. (C) The level of KLHL22 protein was markedly decreased in tumor-infiltrating T cells of CRC patients. Immunohistochemical staining of KLHL22 and CD3e was performed using a colorectal tissue microarray of CRC patients. CD3e staining was used to mark CD3+ T cells, and KLHL22 staining was used to measure KLHL22 expression in CD3+ T cells. Selected samples from the tissue microarrays show KLHL22 expression in CD3+ T cells. Normal colon tissue (Left), atypical hyperplasia (Center), and colon cancer (Right). The number of atypical hyperplasia samples was too low to be included in the subsequent analyses. The 2× magnified image is displayed in the lower right corner. (Scale bar, 20 μm.) (D) Semiquantitative analysis of KLHL22 levels in CRC patients’ CD3+ T cells. Correlation analyses of KLHL22 expression between tumor-infiltrating CD3+ T cells and CD3+ T cells that infiltrated normal adjacent tissues. (E) Bubble chart showing the individual quantities of samples at different levels. Samples with low KLHL22 expression in tumor-infiltrating T cells are in the upper left quadrant of the graph, represented by red bubbles. Samples with high KLHL22 expression in tumor-infiltrating T cells are in the lower right quadrant of the graph, represented by blue bubbles. Larger bubbles indicate a larger number of samples; smaller bubbles are paler in color. Wilcoxon matched-pairs signed rank test: P < 0.0001.

Article Snippet: The Klhl22 KO mouse was created using a CRISPR/Cas9-mediated genome-editing system from Cyagen Biosciences; exon 4 was selected as the target site.

Techniques: Activation Assay, Expressing, Isolation, RNA Extraction, Quantitative RT-PCR, Immunohistochemical staining, Staining, Microarray

Journal: Proceedings of the National Academy of Sciences of the United States of America

Article Title: KLHL22 maintains PD-1 homeostasis and prevents excessive T cell suppression

doi: 10.1073/pnas.2004570117

Figure Lengend Snippet: 5-FU increases the expression of PD-1 by decreasing KLHL22 mRNA levels. (A) Treatment with 5-FU rather than other chemotherapeutic drugs increases PD-1 protein levels. Jurkat cells stably expressing PD-1–FLAG were stimulated with PMA (50 ng/mL 24 h) and ionomycin (1 µM 24 h) in the presence of 5-FU (100 µM 24 h), Etoposide (10 µM, 6 h), MMC (100 nM, 24 h), or CPT-11(10 µM, 24 h), as indicated. Cell-surface levels of PD-1 were measured by flow cytometry. ns, not significant, *P < 0.05, unpaired Student’s t test. (B) 5-FU treatment represses KLHL22 transcription. Jurkat cells were stimulated with PMA (50 ng/mL 24 h) and ionomycin (1 µM 24 h) in the presence of 5-FU (100 µM, 24 h), Etoposide (10 µM, 6 h), Olaparib (10 µM, 24 h), or irradiation (1 Gr) as indicated, and the KLHL22 transcription level was measured by qRT-PCR. ns, not significant, ***P < 0.001, unpaired Student’s t test. (C) 5-FU treatment represses only Klhl22 mRNA levels. CD3+ T cells were freshly isolated from the lymph nodes of WT mice and stimulated with anti-CD3 (1 μg/mL, 24 h) and anti-CD28 (2 μg/mL, 24 h) in the presence or absence of 5-FU (100 µM, 24 h). Klhl22 and Pdcd1 transcription levels were measured by qRT-PCR. ns, not significant, *P < 0.05, unpaired Student’s t test. (D) Deletion of KLHL22 abolishes the effect of 5-FU on PD-1 expression. CD3+ T cells were freshly isolated from the lymph nodes of WT or Klhl22 KO mice and stimulated with anti-CD3 (1 μg/mL, 24 h) and anti-CD28 (2 μg/mL, 24 h) in the presence or absence of 5-FU (100 µM, 24 h). Flow cytometry was used to measure PD-1 levels on the surface of CD8+ or CD4+ T cells. ns, not significant, **P < 0.01, unpaired Student’s t test. (E) 5-FU represses KLHL22 expression in a dose-dependent manner. Jurkat cells were stimulated with PMA (50 ng/mL 24 h) and ionomycin (1 µM 24 h) and treated with a concentration gradient of 5-FU. KLHL22 protein levels were measured by Western blotting. (F) 5-FU increases PD-1 expression in a dose-dependent manner. Jurkat cells were stimulated with PMA (50 ng/mL 24 h) and ionomycin (1 µM 24 h) and treated with a concentration gradient of 5-FU. Cell-surface expression of PD-1 was measured by flow cytometry, *P < 0.05, ***P < 0.001, unpaired Student’s t test. (G) PD-1 is expressed at high levels and KLHL22 is expressed at low levels in patients who received chemotherapy containing 5-FU. Patients were divided into two groups based on whether they had received 5-FU (chemotherapy and no chemotherapy). Tumor-infiltrating lymphocytes were isolated from fresh tumor samples and subjected to flow cytometry analysis to measure cell-surface expression of PD-1 and intracellular expression of KLHL22 in CD3+ T cells. Each point in the figure represents the KLHL22 and PD-1 expression levels of a single patient. Data points corresponding to the chemotherapy group are concentrated in the left region of the figure (red circle), indicating the grouping of patients with low KLHL22 expression and high PD-1 expression, while the no chemotherapy group is concentrated in the lower region of the figure (blue circle), indicating the grouping of patients with high KLHL22 expression and relatively low PD-1 expression. n = 5 patients received chemotherapy and n = 7 patients has not received chemotherapy. Hotelling’s T2 test: P < 0.05. (H) After 5-FU treatment, CD3+ T cells showed reduced KLHL22 expression and increased PD-1 expression compared to that of untreated cells from the same individual patient. PBMCs were isolated from the CRC patients’ blood and divided into two equal volumes. Both were treated with PMA (50 ng/mL 12 h) and ionomycin (1 µM 12 h) in the presence or absence of 5-FU (5-FU and Ctrl, respectively). Flow cytometry analysis was used to measure cell-surface expression on PD-1 and intracellular expression of KLHL22. n = 7 patients, *P < 0.05, paired Student’s t test.

Article Snippet: The Klhl22 KO mouse was created using a CRISPR/Cas9-mediated genome-editing system from Cyagen Biosciences; exon 4 was selected as the target site.

Techniques: Expressing, Stable Transfection, Flow Cytometry, Irradiation, Quantitative RT-PCR, Isolation, Concentration Assay, Western Blot

Journal: Proceedings of the National Academy of Sciences of the United States of America

Article Title: KLHL22 maintains PD-1 homeostasis and prevents excessive T cell suppression

doi: 10.1073/pnas.2004570117

Figure Lengend Snippet: Working model. The biogenesis of PD-1 contains multiple steps of transportation and modification along the ER–Golgi–plasma membrane trafficking axis. KLHL22 is a major interacting protein of PD-1 and recognizes incompletely glycosylated PD-1, subsequently ubiquitinating and degrading PD-1 before it is transported to the cell surface. T cell activation upon TCR stimulation simultaneously promotes PD-1 and KLHL22 expression. KLHL22 degrades incompletely glycosylated PD-1 and maintains PD-1 homeostasis, preventing excessive suppression of T cells. KLHL22 deficiency, as well as deregulation of KLHL22 in response to the tumor microenvironment or 5-FU treatment, leads to excessive accumulation of PD-1 on the T cell surface and the repression of the antitumor immunity activity of T cells.

Article Snippet: The Klhl22 KO mouse was created using a CRISPR/Cas9-mediated genome-editing system from Cyagen Biosciences; exon 4 was selected as the target site.

Techniques: Modification, Clinical Proteomics, Membrane, Activation Assay, Expressing, Activity Assay

Journal: Radiation research

Article Title: RENEB Inter-Laboratory Comparison 2021: The Gene Expression Assay

doi: 10.1667/RADE-22-00206.1

Figure Lengend Snippet: Overview of Participating Teams, Utilized Platforms, Number and Names of Genes or Gene Combinations Used, the Origin of Calibration Samples, and Further Details

Article Snippet: Additionally, all column RNA prep kits remove most of the DNA. (−) RT control conventional PCR (ß-actin primer, HotStar MasterMix (Qiagen), 30 cycles) Check DNA conta mination No cDNA synthesis cDNA synthesis Kit/MasterMix High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) QuantiTect Reverse Transcription (Qiagen) High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) RevertAid First Strand cDNA Synthesis Kit (Thermo Scientific) High Capacity cDNA Archive Kit High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) Kit/MasterMix Quick Amp Labeling Kit (Agilent) PCR protocol 1× /25°C/10min, 1×/37°C/ 120min, 1×/85°C/5min 1×/25°C/10min, 1×/37°C/120min, 1×/85°C/5min 1×/42°C/2min, 1×/42°C/20min, 1×/95°C/3min 1×/25°C/10min, 1×/37°C/120min, 1×/85°C/5min 1×/25°C/5min, 1×/42°C/60min, 1×/l0°C/5min 1×/25°C/10min, 1×/37°C/120min, 1× /85°C/5min 1×/25°C/10min, 1×/37°C/120min PCR protocol 1×/40°C/120min, 1×/70°C/15min; 1 × /40°C/120min Quality control UBC Ct ITFG1 Ct, DPM1 Ct MRPS5 Ct No HPRT1 Ct 18S rRNA Ct Quality control NanoDrop TM qRT-PCR Kit/MasterMix TaqMan Universal Master Mix TaqMan Universal Master Mix II, no UNG (Thermo Fisher Scientific) QuantiFast SYBR Green PCR (Qiagen) 5X HOT FIREPol ® EvaGreen ® qPCR SuperMix, Solis BioDyne TaqMan fast advanced master mix (Applied Biosystems) and Maxima SYBR Green qPCR Master Mix (Thermo Scientific) TaqMan,PerfeCTa ® , MultiPlex qPCR SuperMix, Quanta bioscience TaqMan Universal Master Mix Microarray DNA-Microarray Agilent, 44k whole human genome, G4112F TaqMan assays SYBR Green assay FDXR (Hs00244586_ml), GDF15 (Hs00171132_ml) BAX (Hs00180269_ml), BBC3 (Hs00248075_ml), CDKN1A (Hs00355782_ml), DDB2 (Hs03044953_ml), FDXR (Hs00244586_ml), GADD45A (Hs00169255_ml), GDF15 (Hs00171132_ml), TNFSF4 (Hs00182411_ml) CDKN1A-F: AGACCAGCATGACAGATTTCTACC; CDKN1A-R: CTTCCTGTGGGCGGATTAGG; DDB2-F: AGCATCACTGGGCTGAAGTT; DDB2-R: TGGTGTCTGAGCTGGCAAAA; FDX-F: TGGAGAGAACGGACATCACG; FDX-R: AGCCACACTGTCTTCACTCG GADD45a for: ACTGCGTGCTGGTGACGAAT, GADD45a rev: GTTGACTTAAGGCAGGATCCTTCCA; FDXR for: TGGATGTGCCAGGCCTCTAC, FDXR rev: TGAGGAAGCTGTCAGTCATGGTT; CDKN1A for: CCTGGAGACTCTCAGGGTCGAAA, CDKN1A rev: GCGTTTGGAGTGGTAGAAATCTGTCA; MDM2 for: TATCAGGCAGGGGAGAGTGATACA, MDM2 rev: CCAACATCTGTTGCAATGTGATGGAA; 18S for: GCTTAATTTGACTCAACACGGGA, 18S rev: AGCTATCAATCTGTCAATCCTGTCC.

Techniques: Generated

Journal: Radiation research

Article Title: RENEB Inter-Laboratory Comparison 2021: The Gene Expression Assay

doi: 10.1667/RADE-22-00206.1

Figure Lengend Snippet: Overview of Methodological Details of Either qRT-PCR (Quantitative Reverse Transcription Polymerase Chain Reaction) or Microarrays Used by the Contributing Teams

Article Snippet: Additionally, all column RNA prep kits remove most of the DNA. (−) RT control conventional PCR (ß-actin primer, HotStar MasterMix (Qiagen), 30 cycles) Check DNA conta mination No cDNA synthesis cDNA synthesis Kit/MasterMix High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) QuantiTect Reverse Transcription (Qiagen) High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) RevertAid First Strand cDNA Synthesis Kit (Thermo Scientific) High Capacity cDNA Archive Kit High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) Kit/MasterMix Quick Amp Labeling Kit (Agilent) PCR protocol 1× /25°C/10min, 1×/37°C/ 120min, 1×/85°C/5min 1×/25°C/10min, 1×/37°C/120min, 1×/85°C/5min 1×/42°C/2min, 1×/42°C/20min, 1×/95°C/3min 1×/25°C/10min, 1×/37°C/120min, 1×/85°C/5min 1×/25°C/5min, 1×/42°C/60min, 1×/l0°C/5min 1×/25°C/10min, 1×/37°C/120min, 1× /85°C/5min 1×/25°C/10min, 1×/37°C/120min PCR protocol 1×/40°C/120min, 1×/70°C/15min; 1 × /40°C/120min Quality control UBC Ct ITFG1 Ct, DPM1 Ct MRPS5 Ct No HPRT1 Ct 18S rRNA Ct Quality control NanoDrop TM qRT-PCR Kit/MasterMix TaqMan Universal Master Mix TaqMan Universal Master Mix II, no UNG (Thermo Fisher Scientific) QuantiFast SYBR Green PCR (Qiagen) 5X HOT FIREPol ® EvaGreen ® qPCR SuperMix, Solis BioDyne TaqMan fast advanced master mix (Applied Biosystems) and Maxima SYBR Green qPCR Master Mix (Thermo Scientific) TaqMan,PerfeCTa ® , MultiPlex qPCR SuperMix, Quanta bioscience TaqMan Universal Master Mix Microarray DNA-Microarray Agilent, 44k whole human genome, G4112F TaqMan assays SYBR Green assay FDXR (Hs00244586_ml), GDF15 (Hs00171132_ml) BAX (Hs00180269_ml), BBC3 (Hs00248075_ml), CDKN1A (Hs00355782_ml), DDB2 (Hs03044953_ml), FDXR (Hs00244586_ml), GADD45A (Hs00169255_ml), GDF15 (Hs00171132_ml), TNFSF4 (Hs00182411_ml) CDKN1A-F: AGACCAGCATGACAGATTTCTACC; CDKN1A-R: CTTCCTGTGGGCGGATTAGG; DDB2-F: AGCATCACTGGGCTGAAGTT; DDB2-R: TGGTGTCTGAGCTGGCAAAA; FDX-F: TGGAGAGAACGGACATCACG; FDX-R: AGCCACACTGTCTTCACTCG GADD45a for: ACTGCGTGCTGGTGACGAAT, GADD45a rev: GTTGACTTAAGGCAGGATCCTTCCA; FDXR for: TGGATGTGCCAGGCCTCTAC, FDXR rev: TGAGGAAGCTGTCAGTCATGGTT; CDKN1A for: CCTGGAGACTCTCAGGGTCGAAA, CDKN1A rev: GCGTTTGGAGTGGTAGAAATCTGTCA; MDM2 for: TATCAGGCAGGGGAGAGTGATACA, MDM2 rev: CCAACATCTGTTGCAATGTGATGGAA; 18S for: GCTTAATTTGACTCAACACGGGA, 18S rev: AGCTATCAATCTGTCAATCCTGTCC.

Techniques: Reverse Transcription, Polymerase Chain Reaction, Microarray, Isolation, Red Blood Cell Lysis, Control, Concentration Assay, Sequencing, cDNA Synthesis, Labeling, SYBR Green Assay, Multiplex Assay, TaqMan Assay, Real-time Polymerase Chain Reaction, Software, Extraction

Journal: Radiation research

Article Title: RENEB Inter-Laboratory Comparison 2021: The Gene Expression Assay

doi: 10.1667/RADE-22-00206.1

Figure Lengend Snippet: The Table Depicts Team Contributions (from Left to Right) Regarding Employed Genes, Reported Dose Estimates per Reference Sample 1–3, Differences among Reported and Reference Dose-Values as well as the Summed Absolute Difference over all Reference Samples (SAD), a Correct (Yes) or Incorrect (No) Order of Dose Estimates (from Lowest to Highest) Corresponding to Three Dose Categories [Unexposed, Low (1.2 Gy) and Highly Exposed (3.5 Gy)], the Use of FDXR Gene Expression Changes for dose estimation, as well as the Report Time

Article Snippet: Additionally, all column RNA prep kits remove most of the DNA. (−) RT control conventional PCR (ß-actin primer, HotStar MasterMix (Qiagen), 30 cycles) Check DNA conta mination No cDNA synthesis cDNA synthesis Kit/MasterMix High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) QuantiTect Reverse Transcription (Qiagen) High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) RevertAid First Strand cDNA Synthesis Kit (Thermo Scientific) High Capacity cDNA Archive Kit High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) Kit/MasterMix Quick Amp Labeling Kit (Agilent) PCR protocol 1× /25°C/10min, 1×/37°C/ 120min, 1×/85°C/5min 1×/25°C/10min, 1×/37°C/120min, 1×/85°C/5min 1×/42°C/2min, 1×/42°C/20min, 1×/95°C/3min 1×/25°C/10min, 1×/37°C/120min, 1×/85°C/5min 1×/25°C/5min, 1×/42°C/60min, 1×/l0°C/5min 1×/25°C/10min, 1×/37°C/120min, 1× /85°C/5min 1×/25°C/10min, 1×/37°C/120min PCR protocol 1×/40°C/120min, 1×/70°C/15min; 1 × /40°C/120min Quality control UBC Ct ITFG1 Ct, DPM1 Ct MRPS5 Ct No HPRT1 Ct 18S rRNA Ct Quality control NanoDrop TM qRT-PCR Kit/MasterMix TaqMan Universal Master Mix TaqMan Universal Master Mix II, no UNG (Thermo Fisher Scientific) QuantiFast SYBR Green PCR (Qiagen) 5X HOT FIREPol ® EvaGreen ® qPCR SuperMix, Solis BioDyne TaqMan fast advanced master mix (Applied Biosystems) and Maxima SYBR Green qPCR Master Mix (Thermo Scientific) TaqMan,PerfeCTa ® , MultiPlex qPCR SuperMix, Quanta bioscience TaqMan Universal Master Mix Microarray DNA-Microarray Agilent, 44k whole human genome, G4112F TaqMan assays SYBR Green assay FDXR (Hs00244586_ml), GDF15 (Hs00171132_ml) BAX (Hs00180269_ml), BBC3 (Hs00248075_ml), CDKN1A (Hs00355782_ml), DDB2 (Hs03044953_ml), FDXR (Hs00244586_ml), GADD45A (Hs00169255_ml), GDF15 (Hs00171132_ml), TNFSF4 (Hs00182411_ml) CDKN1A-F: AGACCAGCATGACAGATTTCTACC; CDKN1A-R: CTTCCTGTGGGCGGATTAGG; DDB2-F: AGCATCACTGGGCTGAAGTT; DDB2-R: TGGTGTCTGAGCTGGCAAAA; FDX-F: TGGAGAGAACGGACATCACG; FDX-R: AGCCACACTGTCTTCACTCG GADD45a for: ACTGCGTGCTGGTGACGAAT, GADD45a rev: GTTGACTTAAGGCAGGATCCTTCCA; FDXR for: TGGATGTGCCAGGCCTCTAC, FDXR rev: TGAGGAAGCTGTCAGTCATGGTT; CDKN1A for: CCTGGAGACTCTCAGGGTCGAAA, CDKN1A rev: GCGTTTGGAGTGGTAGAAATCTGTCA; MDM2 for: TATCAGGCAGGGGAGAGTGATACA, MDM2 rev: CCAACATCTGTTGCAATGTGATGGAA; 18S for: GCTTAATTTGACTCAACACGGGA, 18S rev: AGCTATCAATCTGTCAATCCTGTCC.

Techniques: Gene Expression

Journal: Arthritis Research & Therapy

Article Title: Association of circulating microRNAs with prevalent and incident knee osteoarthritis in women: the OFELY study

doi: 10.1186/s13075-019-2086-5

Figure Lengend Snippet: Baseline characteristics of postmenopausal women included in the knee OA study with the localization of OA, if present at other sites than the knee

Article Snippet: Okuhara, 2012 , Trizol reagent (Invitrogen) , Thermocycler (BioRad) , TaqMan miRNA assay kit (Applied) control: U18 , Mini Opticon Real-time PCR System (BioRad) , 146, 155, 181a, 223 upregulated in OA vs CTL ealy stage: 146a and 223 higher than in late stage.

Techniques: Control, Real-time Polymerase Chain Reaction

Journal: Arthritis Research & Therapy

Article Title: Association of circulating microRNAs with prevalent and incident knee osteoarthritis in women: the OFELY study

doi: 10.1186/s13075-019-2086-5

Figure Lengend Snippet: A summary of studies on human miRNAs with dysregulated expression in patients suffering from OA, including the biological fluid tested, the number of patients with their baseline characteristics, the criteria for patient selection, the quantification methods, and the miRNAs significantly dysregulated

Article Snippet: Okuhara, 2012 , Trizol reagent (Invitrogen) , Thermocycler (BioRad) , TaqMan miRNA assay kit (Applied) control: U18 , Mini Opticon Real-time PCR System (BioRad) , 146, 155, 181a, 223 upregulated in OA vs CTL ealy stage: 146a and 223 higher than in late stage.

Techniques: Expressing, Selection, Clinical Proteomics, Biomarker Discovery, Isolation, cDNA Synthesis, Control, Quantitative Proteomics, Diagnostic Assay, Marker, Reverse Transcription, TaqMan microRNA Assay, Real-time Polymerase Chain Reaction, Software, SYBR Green Assay, Gene Expression, Microarray, Labeling, Hybridization, Extraction

Journal: Arthritis Research & Therapy

Article Title: Association of circulating microRNAs with prevalent and incident knee osteoarthritis in women: the OFELY study

doi: 10.1186/s13075-019-2086-5

Figure Lengend Snippet: Differential expression of the miRNA level in the serum from controls and OA patients analyzed by quantitative real-time PCR

Article Snippet: Okuhara, 2012 , Trizol reagent (Invitrogen) , Thermocycler (BioRad) , TaqMan miRNA assay kit (Applied) control: U18 , Mini Opticon Real-time PCR System (BioRad) , 146, 155, 181a, 223 upregulated in OA vs CTL ealy stage: 146a and 223 higher than in late stage.

Techniques: Quantitative Proteomics

Journal: BMC Cancer

Article Title: SNAI2 /Slug promotes growth and invasion in human gliomas

doi: 10.1186/1471-2407-10-301

Figure Lengend Snippet: SNAI2 /Slug mRNA is overexpressed in human gliomas and correlates with histologic grade and invasive phenotype . A ) mRNA expression heatmaps for 30 migration/invasion-related transcription factors. Data shown was obtained from 20 primary human glioblastoma specimens (10 upper panel, 10 lower panel). Changes in glioblastoma gene expression are shown relative to mean expression values obtained from 7 non-tumor brain specimens. Heatmaps are ordered according to their degree of overexpression relative to non-tumor brain. B ) mRNA microarray data for SNAI2 expression in 79 human glioma specimens. Data shown was obtained using 5 non-tumor brain specimens (NTB), 10 supratentorial ganglioglioma (GG) specimens, 15 low grade oligodendroglioma specimens (LGO), 15 low grade astrocytoma specimens (LGA), 7 anaplastic astrocytoma (AA) specimens and 32 glioblastoma (GBM) specimens. Intensity data is plotted on the y axis. SNAI2 /Slug mRNA expression was elevated in glioblastomas compared to low grade astrocytomas ( P < 0.006, t-test). C ) Real-time PCR analysis of SNAI2 /Slug mRNA expression in non-tumor brain (NB), low grade astrocytoma (LGA) and glioblastoma (GBM) specimens. D ) Relative quantification of SNAI2 /Slu g mRNA expression using Real-time PCR in several human glioblastoma cell lines (U343, U251, T98, D566 and U87). Data from non-tumor brain specimens is shown for comparison.

Article Snippet: Probes for β-actin (Hs99999903_m1) and human SNAI2 /Slug (Hs00161904_m1) were purchased from Applied Biosystems (Foster City, CA).

Techniques: Expressing, Migration, Gene Expression, Over Expression, Microarray, Real-time Polymerase Chain Reaction, Quantitative Proteomics, Comparison

Journal: BMC Cancer

Article Title: SNAI2 /Slug promotes growth and invasion in human gliomas

doi: 10.1186/1471-2407-10-301

Figure Lengend Snippet: Slug is overexpressed in glioblastoma and induced by EGF . A) upper panel Western blot analysis of protein isolates derived from 6 human glioblastoma (GBM) and 3 human non-tumor brain (NB) specimens. Blots were stained using a specific anti-Slug antibody. β-actin was used as an internal reference for normalization. The Western blot analysis showed low or absent Slug protein expression in all three non-tumor brain specimens and increased Slug expression in five of six GBM specimens. lower panel mRNA was isolated from the same tumor specimens used in the upper panel and quantitative Real-time PCR for SNAI2 mRNA was performed as described. Data shown are the mean of three replicates. B) upper panel Slug protein was isolated from U251 human GBM cells after exposure to EGF (50 or 100 ng/ml) for 4 hours and assayed by Western blot. β-actin was used as an internal reference for normalization. lower panel Real-time PCR analysis of SNAI2 mRNA from the same samples displayed in the upper panel. Data shown are mean ± SEM of three replicates.

Article Snippet: Probes for β-actin (Hs99999903_m1) and human SNAI2 /Slug (Hs00161904_m1) were purchased from Applied Biosystems (Foster City, CA).

Techniques: Western Blot, Derivative Assay, Staining, Expressing, Isolation, Real-time Polymerase Chain Reaction

Journal: BMC Cancer

Article Title: SNAI2 /Slug promotes growth and invasion in human gliomas

doi: 10.1186/1471-2407-10-301

Figure Lengend Snippet: SNAI2 /Slug overexpression increases glioblastoma growth and proliferation . A ) Phase and fluorescence micrographs showing human U251 glioblastoma cells transduced with a Slug-IRES-EGFP lentivirus. B ) Western blot analysis demonstrating increased Slug protein expression in U251 glioblastoma cells transduced with the Slug-IRES-GFP lentivirus. C ) Colorimetric growth assay demonstrating growth curves for human U251 glioblastoma cells overexpressing a vector containing SNAI2 /Slug (solid line) or an empty control vector (dashed line). Data shown are mean ± SEM. Slug-expressing glioblastoma cells grew at a significantly faster rate than control cells ( P < 0.03, t-test). D ) BrdU incorporation into DNA for human U251 glioblastoma cells overexpressing an SNAI2 /Slug vector or an empty control vector. Data shown are mean ± SEM. SNAI2 /Slug-expressing glioblastoma cells synthesized new DNA at a significantly faster rate than control cells (asterisk indicates P < 0.00001, t-test).

Article Snippet: Probes for β-actin (Hs99999903_m1) and human SNAI2 /Slug (Hs00161904_m1) were purchased from Applied Biosystems (Foster City, CA).

Techniques: Over Expression, Fluorescence, Transduction, Western Blot, Expressing, Growth Assay, Plasmid Preparation, Control, BrdU Incorporation Assay, Synthesized

Journal: BMC Cancer

Article Title: SNAI2 /Slug promotes growth and invasion in human gliomas

doi: 10.1186/1471-2407-10-301

Figure Lengend Snippet: Overexpression of SNAI2 /Slug increases glioblastoma migration and invasion . A ) Scratch wound healing assay for human U251 glioblastoma cells overexpressing a control vector or a SNAI2 /Slug vector. Cells were photographed at 0 hours and 24 hours after scratch application. The dotted lines indicate the original edges of the scratch defect. B ) Transwell migration assay for human U251 glioblastoma cells overexpressing SNAI2 /Slug or a control vector. 10% serum was used as a chemoattractant. The cells that migrated through the membrane were stained and counted under direct microscopy. Slug-expressing glioblastoma cells migrated faster than the control cells (asterisk indicates P < 0.00001, t-test). C ) 3-dimensional Matrigel assay for human U251 glioblastoma cells overexpressing a SNAI2 /Slug vector or a control vector. After 24 hours, cells that invaded through the matrix were fixed, stained with H&E and counted under direct microscopy. Data shown are mean ± SEM. Glioblastoma cells overexpressing Slug showed greater invasiveness than did control cells (asterisk indicates P < 0.001, t-test).

Article Snippet: Probes for β-actin (Hs99999903_m1) and human SNAI2 /Slug (Hs00161904_m1) were purchased from Applied Biosystems (Foster City, CA).

Techniques: Over Expression, Migration, Wound Healing Assay, Control, Plasmid Preparation, Transwell Migration Assay, Membrane, Staining, Microscopy, Expressing, Matrigel Assay

Journal: BMC Cancer

Article Title: SNAI2 /Slug promotes growth and invasion in human gliomas

doi: 10.1186/1471-2407-10-301

Figure Lengend Snippet: Knockdown of endogenous SNAI2 /Slug decreases glioblastoma migration and invasion . A ) Human U87 glioblastoma cells were transduced to over express an shRNA directed against SNAI2 /Slug (shSlug) or a control vector. Total RNA was then collected and analyzed for SNAI2 /Slug mRNA expression by Taqman Real-time PCR. shSlug decreased SNAI2 /Slug mRNA expression by approximately 60%. shRNA-mediated knockdown of Slug protein was confirmed by Western blot (right panel). B ) Transwell migration assay for human U87 glioblastoma cells overexpressing an shRNA directed against SNAI2 /Slug or a control vector. 10% serum was used as a chemoattractant. The cells that migrated through the membrane were stained with H&E and counted under direct microscopy. shSlug-expressing glioblastoma cells migrated slower than the control cells (asterisk indicates P < 0.0002, t-test). C ) 3-dimensional Matrigel assay for human U87 glioblastoma cells overexpressing an shRNA directed against Slug or a control vector. 24 hours after plating, cells that invaded through the matrix were stained and counted under direct microscopy. Data shown are mean ± SEM. Glioblastoma cells overexpressing shSlug showed less invasion than control cells (asterisk indicates P < 0.0001, t-test).

Article Snippet: Probes for β-actin (Hs99999903_m1) and human SNAI2 /Slug (Hs00161904_m1) were purchased from Applied Biosystems (Foster City, CA).

Techniques: Knockdown, Migration, shRNA, Control, Plasmid Preparation, Expressing, Real-time Polymerase Chain Reaction, Western Blot, Transwell Migration Assay, Membrane, Staining, Microscopy, Matrigel Assay

Journal: BMC Cancer

Article Title: SNAI2 /Slug promotes growth and invasion in human gliomas

doi: 10.1186/1471-2407-10-301

Figure Lengend Snippet: Slug promotes glioblastoma growth and decreases survival in vivo . A ) Human U251 glioblastoma cells transduced with a Slug-IRES-EGFP lentivirus or a control lentivirus were implanted subcutaneously into the flanks of nude mice. Quantitative data on tumor growth is shown on the right. Data shown are mean ± SEM (n = 4). Tumors overexpressing Slug grew at a faster rate than control tumors ( P < 0.007 at 4 weeks, t-test). B ) Histological characteristics of U251 glioblastoma tumors shown in A ). Sections are stained with hematoxylin and eosin. Note the spindle morphology of the Slug-overexpressing tumors. C ) CD31 immunoreactivity in U251 glioblastoma tumors overexpressing Slug or a control vector. Increased CD31 immunoreactivity was observed in Slug-overexpressing tumors, indicating the presence of increased vascularity ( P < 0.002, t-test). D) upper panel mRNA microarray data obtained from human U251 glioblastoma cells transduced with either an SNAI2 lentivirus or a control virus. Data are expressed as fold change relative to mRNA expression in control cells. lower panels IL8 mRNA expression after Slug overexpression or Slug knockdown was validated by Real-time PCR in U251-IRES-Slug and U87-ShSlug glioblastma cells, respectively. Data shown are mean ± SEM of three replicates. E ) Regression plot of SNAI2 mRNA versus VEGF mRNA expression. mRNA microarray data was obtained from 20 human glioblastomas. R 2 = 0.068. F ) U87 human glioblastoma cells transduced with a Slug shRNA lentivirus or a control virus were transplanted into the brains of nude mice. Kaplan-Meier survival analysis indicated that SNAI2/ Slug knockdown significantly improved survival ( P < 0.0012, Logrank test).

Article Snippet: Probes for β-actin (Hs99999903_m1) and human SNAI2 /Slug (Hs00161904_m1) were purchased from Applied Biosystems (Foster City, CA).

Techniques: In Vivo, Transduction, Control, Staining, Plasmid Preparation, Microarray, Virus, Expressing, Over Expression, Knockdown, Real-time Polymerase Chain Reaction, shRNA

Journal:

Article Title: A systematic search for downstream mediators of tumor suppressor function of p53 reveals a major role of BTG2 in suppression of Ras-induced transformation

doi: 10.1101/gad.1372606

Figure Lengend Snippet: Microarray profiling of transformation mediated by suppression of p53 and overexpression of H-Rasv12. (A) Hierarchical clustering of expression measurements from 1327 genes in MEFs with down-regulated p53 (56SN1, 56SN5) and in MEFs with down-regulated p53 that overexpress H-RASv12 (56R1, 56R2 56R4 56R7) and that show a consistent pattern of up- or down-regulation compared with primary MEFs. Each row represents a genetically modified MEF cell line and each column represents expression of a single gene across MEF specimens. Red indicates increased gene expression and blue indicates decreased gene expression relative to the median expression level in a primary MEF culture. The right panel shows the proportion of up- and down-regulated genes that exhibit the same pattern of regulation in hierarchically close MEF species. (B) Venn diagram of the number of genes whose suppression was common and unique between p53 dependent immortalization and transformation of MEFs. Down-regulated genes that exhibit the same pattern of regulation in hierarchically close transformed MEFs were intersected with down-regulated genes from immortalized MEFs to identify the targets whose inhibition was mediated only by repression of p53, as opposed to the genes that required additional activity of oncogenic Ras in order to be repressed.

Article Snippet: The following primary antibodies were used: H-Ras (F235), p16 (C-20), p21 (F5, F235), p53 (Pab 246), {"type":"entrez-geo","attrs":{"text":"GSE56","term_id":"56"}} GSE56 (G59-12), cdk4 (C-22) (Santa Cruz), pRb (14001-A, Pharmingen), Phospho-Rb (Ser795), Phospho-Rb (Ser807/811) (Cell Signaling), cyclin D1(Sc-450), and cyclin E1 (M20, C19).

Techniques: Microarray, Transformation Assay, Over Expression, Expressing, Genetically Modified, Inhibition, Activity Assay

Journal:

Article Title: A systematic search for downstream mediators of tumor suppressor function of p53 reveals a major role of BTG2 in suppression of Ras-induced transformation

doi: 10.1101/gad.1372606

Figure Lengend Snippet: Genes repressed in a p53-dependent manner

Article Snippet: The following primary antibodies were used: H-Ras (F235), p16 (C-20), p21 (F5, F235), p53 (Pab 246), {"type":"entrez-geo","attrs":{"text":"GSE56","term_id":"56"}} GSE56 (G59-12), cdk4 (C-22) (Santa Cruz), pRb (14001-A, Pharmingen), Phospho-Rb (Ser795), Phospho-Rb (Ser807/811) (Cell Signaling), cyclin D1(Sc-450), and cyclin E1 (M20, C19).

Techniques: Translocation Assay, Protease Inhibitor, Derivative Assay

Journal:

Article Title: A systematic search for downstream mediators of tumor suppressor function of p53 reveals a major role of BTG2 in suppression of Ras-induced transformation

doi: 10.1101/gad.1372606

Figure Lengend Snippet: Genes repressed in a p53 + HRas v12 -dependent manner

Article Snippet: The following primary antibodies were used: H-Ras (F235), p16 (C-20), p21 (F5, F235), p53 (Pab 246), {"type":"entrez-geo","attrs":{"text":"GSE56","term_id":"56"}} GSE56 (G59-12), cdk4 (C-22) (Santa Cruz), pRb (14001-A, Pharmingen), Phospho-Rb (Ser795), Phospho-Rb (Ser807/811) (Cell Signaling), cyclin D1(Sc-450), and cyclin E1 (M20, C19).

Techniques: Translocation Assay, Variant Assay

Journal:

Article Title: A systematic search for downstream mediators of tumor suppressor function of p53 reveals a major role of BTG2 in suppression of Ras-induced transformation

doi: 10.1101/gad.1372606

Figure Lengend Snippet: Comparison of behavior of the genes that become repressed after p53 knockdown in the presence or absence of oncogenic Ras among three types of cell cultures. (A) Relative expression of the genes that were commonly down-regulated in both immortalized and transformed cells. Values of expression are calculated relative to average gene expression level (dotted line) determined for all genes represented in the array. (B) Northern blot analysis of indicated genes that were down-regulated in MEFs in response to p53 suppression and independent of oncogenic Ras overexpression. (C) Relative expression of the genes that were down-regulated exclusively in transformed cells. Values of expression are calculated relative to average gene expression level (dotted line) determined for all genes represented in the array. (D) Northern blot analysis of indicated genes whose down-regulation was only specific for transformed MEFs where p53 inhibition was accompanied by overexpression of H-Rasv12.

Article Snippet: The following primary antibodies were used: H-Ras (F235), p16 (C-20), p21 (F5, F235), p53 (Pab 246), {"type":"entrez-geo","attrs":{"text":"GSE56","term_id":"56"}} GSE56 (G59-12), cdk4 (C-22) (Santa Cruz), pRb (14001-A, Pharmingen), Phospho-Rb (Ser795), Phospho-Rb (Ser807/811) (Cell Signaling), cyclin D1(Sc-450), and cyclin E1 (M20, C19).

Techniques: Expressing, Transformation Assay, Northern Blot, Over Expression, Inhibition

Journal:

Article Title: A systematic search for downstream mediators of tumor suppressor function of p53 reveals a major role of BTG2 in suppression of Ras-induced transformation

doi: 10.1101/gad.1372606

Figure Lengend Snippet: shRNA-mediated knockdown of BTG2 or p53 allows Ras-mediated transformation of primary MEFs. (A) Primary MEFs were infected with a mixture as well as with individual shRNAs against candidate tumor suppressor genes; all cultures were then superinfected with LRasSN virus-containing supernatants and then seeded at 5 × 105 cells per 100-mm plate. Infected populations were grown in the presence of 0.4 mg/mL of G418. Morphologically transformed colonies appearing 2 wk later were photographed, stained, and counted. (B) Real-time PCR analysis of BTG2 mRNA levels in cells expressing shRNAs for BTG2, p53, and GFP. (C) Semi-quantitative RT-PCR analysis of p53 mRNA levels in cells expressing shRNA for p53, BTG2, and GFP. (D) MEFs transformed by a combination of oncogenic Ras and shRNAs for the indicated genes were resuspended in normal culture medium containing 1.4% methyl cellulose and seeded at 104 cells per well, and in duplicates into six-well plates coated with 1.2% low-melting-point agarose. Cultures were grown under standard tissue culture conditions, cells were fed twice weekly, and the number of macroscopically visible foci was scored after 3 wk. (E) The ability to form tumors in vivo was assessed by injecting 4 × 106 transformed cells under the skin of both flanks of athymic nu/nu mice; growth of tumors was analyzed 18 d later. (F) Levels of BTG2 mRNA in MEFs expressing GSE56 + HRas, GSE56, or EGFP used for microarray analysis determined by real-time PCR. (G) p53 retains its transactivation ability in the cell with down-regulated BTG2 (results of detection of the activity of p53-responsive lacZ after induction with the indicated DNA-damaging drugs). (H) Western blot analysis of p21 expression in MEFs transduced with constructs expressing shRNAs against the indicated genes with or without oncogenic H-RASv12. β-Actin is used as loading control. (J) Semi-quantitative RT-PCR analysis of ARF mRNA levels in MEFs expressing shRNA against p53, BTG2 and GFP, with or without oncogenic H-RASv12.

Article Snippet: The following primary antibodies were used: H-Ras (F235), p16 (C-20), p21 (F5, F235), p53 (Pab 246), {"type":"entrez-geo","attrs":{"text":"GSE56","term_id":"56"}} GSE56 (G59-12), cdk4 (C-22) (Santa Cruz), pRb (14001-A, Pharmingen), Phospho-Rb (Ser795), Phospho-Rb (Ser807/811) (Cell Signaling), cyclin D1(Sc-450), and cyclin E1 (M20, C19).

Techniques: shRNA, Transformation Assay, Infection, Staining, Real-time Polymerase Chain Reaction, Expressing, Quantitative RT-PCR, In Vivo, Microarray, Activity Assay, Western Blot, Transduction, Construct

Journal:

Article Title: A systematic search for downstream mediators of tumor suppressor function of p53 reveals a major role of BTG2 in suppression of Ras-induced transformation

doi: 10.1101/gad.1372606

Figure Lengend Snippet: Inhibition of BTG2 rescues human diploid embryonic lung fibroblasts, IMR90, from oncogene-mediated growth arrest. (A) IMR-90 cells infected with shRNAs against BTG2, p53, and GFP were superinfected with lentivirus-expressing H-Rasv12 + Neor cassette and selected in G418-containing media for 14 d, after which surviving resistant cells were fixed and stained with Methylene Blue. (B) Resistant IMR-90 cells expressing H-Rasv12 + Neor and shRNAs for the indicated genes were stained for senescence-associated endogenous β-galactosidase activity and photographed. Results were calculated as the percentage of visible cells that had positive staining (at least five different fields were counted for each plate). (C) BTG2 expression is down-regulated in IMR-90 cells that express shRNA for BTG2 or p53 as measured by real-time PCR.

Article Snippet: The following primary antibodies were used: H-Ras (F235), p16 (C-20), p21 (F5, F235), p53 (Pab 246), {"type":"entrez-geo","attrs":{"text":"GSE56","term_id":"56"}} GSE56 (G59-12), cdk4 (C-22) (Santa Cruz), pRb (14001-A, Pharmingen), Phospho-Rb (Ser795), Phospho-Rb (Ser807/811) (Cell Signaling), cyclin D1(Sc-450), and cyclin E1 (M20, C19).

Techniques: Inhibition, Infection, Expressing, Staining, Activity Assay, shRNA, Real-time Polymerase Chain Reaction

Journal:

Article Title: A systematic search for downstream mediators of tumor suppressor function of p53 reveals a major role of BTG2 in suppression of Ras-induced transformation

doi: 10.1101/gad.1372606

Figure Lengend Snippet: BTG2 cooperates with p53 to prevent transformation of human IMR90 cells. (A) Primary IMR90 cells were sequentially infected to express a combination of oncogenic elements that are required but not sufficient for tumorigenic transformation (TERT/st/GSE56/Ras), and then super infected with shRNA lentiviral constructs against the indicated genes. Cells were grown in methyl cellulose and the number of macroscopically visible foci was scored after 3 wk. (B) Western blot analysis of genetically transduced IMR90 cells for the expression of the indicated proteins. (C) A model in which BTG2 integrates p53 and other signaling networks to control cell division. Cell proliferation and, ultimately, formation of malignant tumors largely depends on pRb phosphorylation status, which controls the activity of the E2F family of transcription factors necessary for induction of the genes that regulate DNA synthesis. Rb phosphorylation status is, in turn, mediated by CDKs bound to activating cyclins. Oncogenic and other stress signals that might lead to the formation of a malignant phenotype activate BTG2 through p53-dependent and p53-independent mechanisms leading to reduced expression of D- and E-type cyclins, hypophosphorylation of Rb, and the inhibition of cell growth.

Article Snippet: The following primary antibodies were used: H-Ras (F235), p16 (C-20), p21 (F5, F235), p53 (Pab 246), {"type":"entrez-geo","attrs":{"text":"GSE56","term_id":"56"}} GSE56 (G59-12), cdk4 (C-22) (Santa Cruz), pRb (14001-A, Pharmingen), Phospho-Rb (Ser795), Phospho-Rb (Ser807/811) (Cell Signaling), cyclin D1(Sc-450), and cyclin E1 (M20, C19).

Techniques: Transformation Assay, Infection, shRNA, Construct, Western Blot, Expressing, Activity Assay, DNA Synthesis, Inhibition